Check patentability & draft patents in minutes with Patsnap Eureka AI!

Lactobacillus plantarum nitrite reductase gene, and encoded protein and application of the same

A technology of Lactobacillus plantarum and nitrite applied in the field of genetic engineering

Inactive Publication Date: 2012-07-11
SHANGHAI INST OF TECH
View PDF1 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the gene of plant lactic acid bacteria nitrite reductase and the enzyme protein sequence encoded by the gene have not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lactobacillus plantarum nitrite reductase gene, and encoded protein and application of the same
  • Lactobacillus plantarum nitrite reductase gene, and encoded protein and application of the same
  • Lactobacillus plantarum nitrite reductase gene, and encoded protein and application of the same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] A kind of artificially synthesized gene of Lactobacillus plantarum nitrite reductase, its base sequence is as SEQ ID NO: 1, and this sequence is obtained by the following method:

[0055] (1), PCR primer design

[0056] Using the nitrite reductase gene of Staphylococcus aureus, Pseudomonas aeruginosa, Brucella; Escherichia coli as a reference, PCR primers were designed: the upstream primer was 5'GCGGATCCATGAGTCAAAGCTTATG3' (BamHI), See SEQ ID NO:3, the downstream primer is 5'CCG CTCGAG TTAATTCCGTACACTG3' (XhoⅠ), see SEQ ID NO:4, and artificially synthesized;

[0057] (2) Extraction of genomic DNA of Lactobacillus plantarum nitrite reductase

[0058] ①. The culture of Lactobacillus plantarum (preservation number CCTCC NO 22708) was centrifuged at 5000r / min for 15min, the supernatant was discarded, and 0.05g of the precipitate (bacteria) was put into 1.5ml EP, and 1ml TE buffer was added to make After the precipitate is evenly suspended, centrifuge at 12000r / min for 1...

Embodiment 2

[0069] Containing the construction of the recombinant expression vector of the genomic DNA of the Lactobacillus plantarum nitrite reductase of the PCR expansion of the gained of embodiment 1, the steps are as follows:

[0070] Ligate the PCR-expanded Lactobacillus plantarum nitrite reductase genomic DNA obtained in Example 1 with the pET-32a(+) expression vector, react at room temperature for 30 minutes, then keep it at 80°C for 10 minutes, cool to 4°C, and obtain the connection Product, connection reaction system is as follows:

[0071]

[0072] Then transform the above ligation product into TG1 cells to obtain the recombinant plasmid pET-32a(+)-NirL;

[0073] The obtained recombinant plasmid pET-32a(+)-NirL was identified by PCR and double enzyme digestion. figure 2 shown, from figure 2 It can be seen that the constructed vector was successfully digested by BamHI and XholⅠ at the GGATCC and CTCGAG sites respectively;

[0074] The results of PCR identification of pET-...

Embodiment 3

[0079] Transform the expression vector pET-32a(+)-NiRs plasmid constructed in Example 2 into BL21(DE3) competent cells to obtain recombinant Escherichia coli. The specific steps are as follows:

[0080] ①. Take 5 μL of the ligation product, add it to 200 μL E.coli TG1 competent cell suspension, mix gently, and place on ice for 30 min;

[0081] ②. Shock in a water bath at 42°C for 90 sec, quickly remove and cool on ice for 5 min;

[0082] ③. Add 800 μL LB liquid medium preheated at 37°C, mix well and then bathe in water at 37°C for 1 hour to restore the bacteria to normal growth state;

[0083] ④. Centrifuge at 4000 r / m for 10 min, discard 800 μL of the supernatant, take the remaining 200 μL of the bacterial solution and spread it evenly on the LB solid medium plate, and place it face-up at 37°C for 30 minutes, until the bacterial solution is completely absorbed by the medium Then invert for 8-12 h;

[0084] ⑤. Pick a single clone and identify it by PCR. The positive clone cu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Lactobacillus plantarum nitrite reductase gene, a recombinant vector containing the gene, a host converted by the vector, an expression product produced by utilization of the converted body, and the application of the product. Staphylococcus aureus, pseudomonas aeruginosa, brucella, and nitrite reductase gene of escherichia coli serve as references for a primer design, genome DNA extracted by Lactobacillus plantarum serves as a template, and the gene segments of Lactobacillus plantarum nitrite reductase are amplified via the PCR technique; the segments are connected to a pET-32a(+) expression vector and then transferred to escherichia coli BL21(DE3) cells; and after IPTG induction, expression of Lactobacillus plantarum nitrite reductase (NiRL) protein is carried out, finally obtaining Lactobacillus plantarum nitrite reductase protein.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a plant lactobacillus nitrite reductase gene, a recombinant vector containing the gene, a host transformed with the vector, and the use of the transformant to produce an expression product of the gene and its application. Background technique [0002] Nitrite reductase is a class of enzymes that catalyze the reduction of nitrite. Nitrite widely exists in pickled or fresh food and feed. Excessive nitrite in food will oxidize hemoglobin into methemoglobin, reduce the oxygen carrying capacity of the blood, cause methemoglobinemia, and cause serious harm to the human body. Nitrite can also react with secondary amines, tertiary amines and amino compounds in the human body to form strong carcinogen nitrosamine compounds, thereby inducing canceration of the digestive system. In view of the fact that excessive nitrite pollution in food can cause food safety probl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/53C12N15/63C12N15/70C12N15/75C12N1/21C12N9/06C12R1/25C12R1/19C12R1/125
Inventor 龚钢明何婷婷高然
Owner SHANGHAI INST OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More