Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of orally-taken vaccine for treatment of hemorrhage of grass carp

A technology of oral vaccines for grass carp hemorrhagic disease, which is applied in the field of preparation of oral vaccines for grass carp hemorrhagic disease, can solve problems such as the preparation of oral vaccines for grass carp hemorrhagic disease, achieve significant immune effect, low cost, and simple preparation process

Inactive Publication Date: 2012-08-01
SUZHOU UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, there is no report on the preparation of an oral vaccine against grass carp hemorrhagic disease using the silkworm baculovirus expression vector system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of orally-taken vaccine for treatment of hemorrhage of grass carp
  • Preparation method of orally-taken vaccine for treatment of hemorrhage of grass carp
  • Preparation method of orally-taken vaccine for treatment of hemorrhage of grass carp

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Preparation of VP6 silkworm larvae expressing grass carp hemorrhagic disease virus (GCRV)

[0042] 1. Use QIAGEN Viral RNA Mini Kit (Qiagen company) to extract grass carp hemorrhagic disease virus genome RNA, use RNA PCR Kit Ver.3.0 (Qiagen company) to convert viral RNA into cDNA according to the product catalog, according to the grass carp hemorrhagic disease virus structural protein VP6 cDNA coding sequence (GenBank accession number: AF403394) designed primers GCRV-EI-6 (GGCGAATTC ATGGCACAGCGTCAGTTTTTCGG, underlined indicates EcoRI restriction site) and GCRV-HD-6 (TCGAAGCTTAGACGAACATCGCCTGCGC, underlined indicates HindIII restriction site), synthesized by PCR The coding sequence of VP6 gene with EcoRI and HindⅢ sites at the 5'end and 3'end, respectively, was cloned into the T-vector to obtain the pMD19T-VP6 plasmid.

[0043] 2. Digest the pMD19T-VP6 plasmid with EcoRI / HindⅢ double enzyme digestion, recover the VP6 gene fragment (1.23 kb), digest the donor plasmi...

Embodiment 2

[0053] Example 2: Preparation of silk carp hemorrhagic disease virus (GCRV) VP6 silkworm pupae

[0054] 1. The P3 generation recombinant virus BmNPV-IIVP6 obtained in step 7 of Example 1 was used to infect BmN cultured cells, and the cell culture supernatant was collected 4 days later.

[0055] 2. Take the cell culture supernatant from step 1 with insect acupuncture, puncture the silkworm pupae that are about 2 days old at the link, and protect them at 25°C for 5 days. Take a small amount of pupa blood and perform SDS-PAGE and Western blotting for detection. The expression level of VP6 was estimated by gray scale analysis on SDS-PAGE gel. The results showed that the molecular weight of the recombinant VP6 protein was about 53kD, and the VP6 protein expression level was the highest after 5 days of infection, accounting for about 5.5% of the total pupa hemolymph protein. The silkworm pupae 5 days after virus inoculation were collected and stored at -20°C.

Embodiment 3

[0056] Example 3: Preparation of lyophilized powder for expressing VP6 silkworm pupa

[0057] 1. Take 10 kg of silkworm pupae from step 2 of Example 2, homogenize in ice bath, add 40 kg of 0.7% saline, mix well, filter with gauze to remove coarse impurities.

[0058] 2. The filtrate is freeze-dried to a moisture content of less than 2%, crushed and sieved to make powder raw materials.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a preparation method of an orally-taken vaccine for treatment of hemorrhage of a grass carp, which comprises the following steps of: (1) preparing a recombinant baculovirus BmNPV-IIVP6 with hemorrhagic virus structure protein VP6 genes of the grass carp in a genetic engineering method; (2) grafting the amplified recombinant baculovirus BmNPV-IIVP6 to a five-instar silkworm larvae or pupae; (4) collecting the silkworm larvae or pupae subjected to virus inoculation after 4 to 6 days, and preparing freeze-dried powder in a freeze-drying method; and (4) mixing the freeze-dried powder prepared in Step (3) and powdered fish feed, to obtain the orally-taken vaccine for treatment of hemorrhage of the grass carp. The content of the freeze-dried powder in the orally-taken vaccine for treatment of hemorrhage of the grass carp is 1-10 percent by weight. The vaccine can be directly used as an orally-taken vaccine, and has the advantages of simple preparation process, low cost, convenient use and dual functions of protein subunit vaccines and nucleic acid vaccines.

Description

Technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for preparing an oral vaccine for grass carp hemorrhagic disease by using a silkworm bioreactor. Background technique [0002] grass carp( Ctenopharyngodon idellus ) Is the main species of freshwater aquaculture in my country, and its output accounts for about 20% of the total freshwater aquaculture output. However, there are many diseases of grass carp. Among them, hemorrhagic disease of grass carp (hemorrhagic disease of grass carp) is the most serious, which is caused by grass carp hemorrhagic disease virus ( Grass Carp Reovirus, GCRV). The disease is the biggest disease in the breeding stage of fingerlings, with a mortality rate of over 90%, causing huge losses to the aquaculture industry. [0003] In the prior art, in the immune prevention of grass carp hemorrhagic disease, formaldehyde inactivated vaccines are mainly used. For example, take the grass carp that has b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/15A61P31/14C12N15/46C12N7/01C12N15/866
Inventor 贡成良薛仁宇曹广力陈辉刘林徐诗英邹勇
Owner SUZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com