Preparation method of orally-taken vaccine for treatment of hemorrhage of grass carp
A technology of oral vaccines for grass carp hemorrhagic disease, which is applied in the field of preparation of oral vaccines for grass carp hemorrhagic disease, can solve problems such as the preparation of oral vaccines for grass carp hemorrhagic disease, achieve significant immune effect, low cost, and simple preparation process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1: Preparation of VP6 silkworm larvae expressing grass carp hemorrhagic disease virus (GCRV)
[0042] 1. Use QIAGEN Viral RNA Mini Kit (Qiagen company) to extract grass carp hemorrhagic disease virus genome RNA, use RNA PCR Kit Ver.3.0 (Qiagen company) to convert viral RNA into cDNA according to the product catalog, according to the grass carp hemorrhagic disease virus structural protein VP6 cDNA coding sequence (GenBank accession number: AF403394) designed primers GCRV-EI-6 (GGCGAATTC ATGGCACAGCGTCAGTTTTTCGG, underlined indicates EcoRI restriction site) and GCRV-HD-6 (TCGAAGCTTAGACGAACATCGCCTGCGC, underlined indicates HindIII restriction site), synthesized by PCR The coding sequence of VP6 gene with EcoRI and HindⅢ sites at the 5'end and 3'end, respectively, was cloned into the T-vector to obtain the pMD19T-VP6 plasmid.
[0043] 2. Digest the pMD19T-VP6 plasmid with EcoRI / HindⅢ double enzyme digestion, recover the VP6 gene fragment (1.23 kb), digest the donor plasmi...
Embodiment 2
[0053] Example 2: Preparation of silk carp hemorrhagic disease virus (GCRV) VP6 silkworm pupae
[0054] 1. The P3 generation recombinant virus BmNPV-IIVP6 obtained in step 7 of Example 1 was used to infect BmN cultured cells, and the cell culture supernatant was collected 4 days later.
[0055] 2. Take the cell culture supernatant from step 1 with insect acupuncture, puncture the silkworm pupae that are about 2 days old at the link, and protect them at 25°C for 5 days. Take a small amount of pupa blood and perform SDS-PAGE and Western blotting for detection. The expression level of VP6 was estimated by gray scale analysis on SDS-PAGE gel. The results showed that the molecular weight of the recombinant VP6 protein was about 53kD, and the VP6 protein expression level was the highest after 5 days of infection, accounting for about 5.5% of the total pupa hemolymph protein. The silkworm pupae 5 days after virus inoculation were collected and stored at -20°C.
Embodiment 3
[0056] Example 3: Preparation of lyophilized powder for expressing VP6 silkworm pupa
[0057] 1. Take 10 kg of silkworm pupae from step 2 of Example 2, homogenize in ice bath, add 40 kg of 0.7% saline, mix well, filter with gauze to remove coarse impurities.
[0058] 2. The filtrate is freeze-dried to a moisture content of less than 2%, crushed and sieved to make powder raw materials.
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com