Unlock instant, AI-driven research and patent intelligence for your innovation.

Method and special primers for fast identifying phytophthora capsici leonian resistance to pyrimorph

A technology of Phytophthora capsici and drug resistance, applied in the field of molecular biology, can solve the problems of long detection cycle, heavy workload, human resources and materials, etc., and achieve the effect of delaying further development

Active Publication Date: 2013-01-02
CHINA AGRI UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods all need to obtain the pure culture of pathogenic bacteria through isolation and culture under in vitro conditions, and determine the EC of the agent on the pathogenic bacteria. 50 , with the help of the established sensitive baseline, the difference between sensitive and resistant strains is compared. The test requires multiple treatments and multiple repetitions, so the detection cycle is long, the workload is heavy, and the consumption of human resources and materials is large.
Moreover, the detection sensitivity of the above-mentioned conventional methods is low, and the mutation frequency of drug-resistant strains can only be detected when it is above 1%.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and special primers for fast identifying phytophthora capsici leonian resistance to pyrimorph
  • Method and special primers for fast identifying phytophthora capsici leonian resistance to pyrimorph
  • Method and special primers for fast identifying phytophthora capsici leonian resistance to pyrimorph

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1, Phytophthora capsici are sensitive to pyrimorph

[0030] Three Phytophthora capsici resistant mutants, strain numbers R3-2, R3-3, and R11-1; two Phytophthora capsici sensitive parent strains, strain numbers Hd3 and Hd11 respectively.

[0031] Potato dextrose agar (PDA) medium: 200 g of potatoes, 13 g of agar powder, 18 g of glucose, distilled water to 1 L, sterilized at 121° C. for 20 minutes.

[0032] 1. The experimental steps are as follows:

[0033] 1) Pyramorpholine is prepared into 10 with dimethyl sulfoxide (DMSO) 4 μg / ml stock solution. For the susceptibility determination of Phytophthora capsici sensitive strains, pyrimorph was diluted stepwise to 187.5 μg / mL, 375 μg / mL, 750 μg / mL, 1.5×10 3 μg / mL, 3×10 3 μg / mL, 4×10 3 Concentration gradient of μg / mL; For the sensitivity determination of Phytophthora capsici resistant strains, the test agent fenpyramorph was diluted stepwise to 312.5μg / mL, 625μg / mL, 1.25×10 3 μg / mL, 2.5×10 3 μg / mL, 5×10 3 μg...

Embodiment 2

[0042] Embodiment 2, discovery of CesA3 gene and CesA3 protein mutation site in Phytophthora capsici

[0043] 1. Strains: resistant strains are R3-2, R3-3, R11-1; sensitive strains are Hd3 and Hd11.

[0044] 2. Method:

[0045] 1) Strain cultivation: use PDA medium (200 g of peeled potatoes, 18 g of glucose, 13 g of agar powder, and distilled water to make up to 1 L. 121 ° C, 20 min, after damp heat sterilization) to cultivate Phytophthora capsici at 28 ° C. The pre-cultured Phytophthora capsici sensitive strains were inoculated on PDA medium covered with cellophane, cultured in the dark at 28°C for 5 days, and the hyphae were collected, frozen in liquid nitrogen and stored at -80°C for genomic DNA extraction.

[0046] 2) Genomic DNA of Phytophthora capsici sensitive strains and resistant strains were extracted respectively:

[0047] Take an appropriate amount of mycelium frozen in liquid nitrogen, grind it into powder with a mortar, and place it in a 1.5mL centrifuge tube; ...

Embodiment 3

[0068] Embodiment 3, the method for detecting mutation site in Phytophthora cucurbita

[0069] 1. Primer design

[0070] The bacterial strain is the bacterial strain used in Example 1.

[0071] The primers are shown in Table 2. Allele specific-PCR primers were designed according to the sequence of the mutant cesA3 gene. The last base at the 3'-end of the forward primer RF1077 was consistent with the mutated base. In order to increase the specificity of the primer, reverse The second base at the 3'-end of the primer introduces a mismatched base T (SEQ ID NO: 2); the reverse primer is R1077 (SEQ ID NO: 3).

[0072] Table 2.PCR detection of Phytophthora capsici to the primers used in the resistant strain of fungicide fenpyrimorph

[0073] Primer

Sequence (5'-3')

CF1077 (forward)

GTTCTTCGGGTTCTTCGTAATGAG (sequence 1)

R1077B (forward)

TCTTCGGGTTATTCGTGATGAGTA (sequence 2)

R1077 (reverse)

CGAACACCACGATGTACACCTG (Sequence 3)

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to identification of nucleotide point mutation of a phytophthora capsici leonian-cellulose synthase-related gene CesA3 and a use of the phytophthora capsici leonian-cellulose synthase-related gene CesA3 in detection of resistance to pyrimorph as a fungicide, and discloses a molecular detection method and special primers for identifying phytophthora capsici leonian gene CesA3 3365-site nucleotide mutation-caused resistance to pyrimorph. The pair of special primers is composed of DNA molecules shown in the formulas of SEQ ID NO: 2 and SEQ ID NO: 3. The molecular diagnosis method for detecting phytophthora capsici leonian resistance to pyrimorph as a fungicide has high sensitivity, good stability and a short detection period, can be used for high-flux detection of generation and development of field phytophthora capsici leonian resistance to pyrimorph as a fungicide, realizes early warning of diseases with resistance and has an important meaning for timely and effective control of development of diseases with resistance.

Description

technical field [0001] The present invention relates to the identification of nucleotide point mutation of Phytophthora capsici cellulose synthase-related gene CesA3 and its application in the monitoring of fungicide resistance to pyrimorph, and specifically discloses a nucleoside for rapid identification of Phytophthora capsici CesA3 gene Molecular detection method and special primers for acid point mutation and its resistance to fenpyroline. It belongs to the technical field of molecular biology. Background technique [0002] Phytophthora capsici Leonian is an important plant pathogenic oomycete. The pepper blight caused by Phytophthora capsici Leonian infecting peppers is a worldwide distribution of devastating diseases, which commonly occurs in my country and increases year by year. trend. Under the condition of suitable climate, it can break out in a short period of time, and the spread speed is extremely fast. Generally, the onset can cause 30% yield loss, and in seve...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12N9/58C12N15/57C12R1/645
Inventor 刘西莉庞智黎陈磊邵菁芃李健强覃兆海刘鹏飞
Owner CHINA AGRI UNIV