Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Murine human colorectal cancer-resistant Fab phage antibody library and construction method thereof

A technology for a phage antibody library and a construction method is applied in the field of construction of a mouse anti-human colorectal cancer Fab antibody library to achieve the effects of improved accuracy and sensitivity and a simple method

Inactive Publication Date: 2013-01-23
DALIAN UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Firstly, the target gene fragment is cloned into the phagemid vector, and transformed into the F pili E. coli in the host; then the auxiliary M13 phage binds to the F pili of the host bacterium through a ligand structure composed of gp3, gp6, and gp7 at one end, and gradually releases its genome into the host bacterium; the phage replicates in the host bacterium, and the phage The plasmid vector also expresses the phage structural protein fused with the foreign protein, and the phage nucleocapsid will mistakenly package the phagemid vector into it, and this wrongly packaged phage can reinfect E. coli host bacteria, but cannot amplify new phages again

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Murine human colorectal cancer-resistant Fab phage antibody library and construction method thereof
  • Murine human colorectal cancer-resistant Fab phage antibody library and construction method thereof
  • Murine human colorectal cancer-resistant Fab phage antibody library and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Immunize BALB / C mice

[0033] 1. Mix 21 cases of drug-resistant colorectal cancer tissues in equal amounts and place them in a weighed centrifuge tube, then add an appropriate amount of sterile saline, homogenize, sterilize, and mix with Freund's incomplete adjuvant 1:1 evenly , To obtain colorectal cancer tissue homogenate for immunization;

[0034] 2. Take multi-point injection (0.2mL / 10g) of colorectal cancer tissue homogenate for immunization to immunize BALB / C mice, and immunize BALB / C mice again in the same way on 7 days and 14 days after the first immunization, and 7 days after the last immunization Take blood from the orbit, centrifuge, and save the supernatant for use;

[0035] 3. Enzyme-linked immunosorbent assay (ELISA) to determine antibody titer: ①Coat the wells of the ELISA plate with the above-mentioned colorectal cancer tissue homogenate (100μL / well), and incubate at 37°C for 2 hours; ②Discard the homogenate and use 3% BSA The ELISA plate is blocked by f...

Embodiment 2

[0037] Obtain mouse spleen cDNA library

[0038] 1. Extract total RNA from spleen of immunized mice

[0039] (1) The mouse was killed, the spleen was taken out and placed in normal saline. The mouse spleen was cut into small pieces with scissors and washed with normal saline, then placed in liquid nitrogen and fully frozen. The frozen tissue pieces were put into pre-cooled Store in a centrifuge tube at -80°C and take it out when used;

[0040] (2) After fully pre-cooling the mortar with liquid nitrogen, put 50-100mg of spleen tissue into the mortar, grind it into a powder, add 1mL Trizol and continue grinding until it becomes uniform and transparent;

[0041] (3) Transfer the grinding solution to a centrifuge tube, leave it at room temperature for 5 minutes, centrifuge at 4°C, 13500 rpm for 5 minutes, and transfer the supernatant to a new centrifuge tube;

[0042] (4) Add 200μL of chloroform, cover the centrifuge tube tightly, shake vigorously for 15 seconds by hand, until the solutio...

Embodiment 3

[0054] Design primers and amplify gene fragments

[0055] 1. Design mouse Fab antibody primers

[0056] (1) Design 17 heavy chain upstream primers and 5 heavy chain downstream primers, with 5′ end introduced in the heavy chain primers Xho Ⅰ Restriction site, 3′ end introduced Spe Ⅰ Restriction site, see Table 1; 20 light chain upstream primers and 2 light chain downstream primers are designed, and the 5′ end of the light chain primer is introduced Sac Ⅰ restriction site, 3′ end primer introduced Xba Ⅰ restriction site, see Table 2;

[0057] Primer number Primer sequence HS1 GCCCTCGAGCAGATCCAGCTACAACAGTC HS2 GCCCTCGAGCAGGTCCAGCTGAAGCAGTC HS3 GCCCTCGAGCAGGTCCAACTGCAGCAGC HS4 GCCCTCGAGCAGGTTCAACTGCAACAGTC HS5 GCCCTCGAGCAGATCCAGTTGGTACAGTC HS6 GCCCTCGAGCAGATTACTCAGAAAGAGTC HS7 GCCCTCGAGCAGGTGCAGCTGAAGGAGTC HS8 GCGCTCGAGGAGGTCCAGCTGCAGCAGTC HS9 GCGCTCGAGGAGGTCCAGCTGCAACAATC HS10 GCGCTCGAGGAGGTACAGCTTCAGGAGTC HS11 GCGCTCGAGGAGGTGAAGCTGGTGGAAAC HS12 GCGCTCGAGGAAGTGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a murine human colorectal cancer-resistant Fab phage antibody library and a construction method of the murine human colorectal cancer-resistant Fab phage antibody library, belonging to the field of antibody libraries and preparation of the antibody libraries. The construction method for the murine human colorectal cancer-resistant Fab phage antibody library comprises the steps of: taking multidrug-resistant colorectal cancer pathological tissues, injecting BALB / C to adult mice, killing mice to take spleen tissues when detecting the antibody titer is greater than 1:512, extracting total RNA of the spleen tissues and conducting reverse transcription into cDNA; by taking the cDNA as a formwork, designing 17 heavy-chain forward primers and 5 heavy-chain reverse primers, 20 light-chain forward primers and 2 light-chain reverse primers, carrying out PCR (Polymerase Chain Reaction) amplification to obtain heavy-chain Fd segment and light chain kappa and chain lambada, sequentially cloning into a pComb3 carrier and transforming into E.coliXL-Blue, successfully constructing an anti-P-gpFab immunity antibody with library capacity of 2.47*106CFU, wherein the average insertion rate of the heavy-chain Fd segment achieves 80%, the average insertion rate of the light chain achieves 90%, and the Fab insertion rate achieves 72%.

Description

technical field [0001] The invention belongs to the field of antibody library and preparation thereof, in particular to a method for constructing a mouse anti-human colorectal cancer Fab antibody library [0002] Law. Background technique [0003] Multi-drug resistance (MDR) of tumor cells is mostly acquired drug resistance, that is, they are sensitive to drugs before treatment and resistant to drugs after treatment. Multidrug resistance refers to not only resistance to the drugs used, but also cross-resistance to other drugs with completely different structures and mechanisms of action. The most important reason for the multidrug resistance of tumor cells is the overexpression of an ATP-dependent efflux pump in the tumor cell membrane to reduce the accumulation of chemotherapy drugs inside the cell. This ATP-dependent efflux pump belongs to the ABC (ATP-binding cassette) transporter superfamily, mainly including the following types: (1) Tumor multidrug resistance protein...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C40B40/10C12N15/13C12N15/63C07K16/30
Inventor 张学梅梁文波曹阳张海玉王清
Owner DALIAN UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More