High glucose resistance beta-glucosidase-CBD fusion enzyme, and expression gene and application thereof

A technology of glucosidase and high sugar resistance, applied in the fields of application, genetic engineering, plant genetic improvement, etc., to achieve the effect of strong cellulose binding ability

Active Publication Date: 2014-06-18
NANJING FORESTRY UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no literature report on the fusion of the β-glucosidase and the cellulose-binding domain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High glucose resistance beta-glucosidase-CBD fusion enzyme, and expression gene and application thereof
  • High glucose resistance beta-glucosidase-CBD fusion enzyme, and expression gene and application thereof
  • High glucose resistance beta-glucosidase-CBD fusion enzyme, and expression gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Acquisition of high glucose tolerance β-glucosidase gene of T.thermosaccharolyticum DSM571 and construction of recombinant plasmid pET-BGL

[0033] 1.1 Culture of T.thermosaccharolyticum DSM571

[0034]T.thermosaccharolyticum DSM571 was purchased from DSMZ Culture Collection Center (www.dsmz.de) with number 571. The medium formula is: 10g / L starch (starch), 5g / L tryptone (tryptone), 3g / L yeast extract (yeast extract), 5g / L meat extract (meat extract), 10g / L2-? morpholinoethanesulfonic acid (2-morpholinoethanesulfonic), 10mg / L FeSO 4 ·7H 2 O, 1mg / L resazurin, adjust the pH to 7.2, boil and fill with nitrogen to remove oxygen, and put the culture medium into an anaerobic bottle for sterilization under anaerobic conditions. Inoculate with a syringe according to the inoculation amount of 0.5%wt, culture statically at 63°C for 24h, and collect the cells.

[0035] 1.2 Genomic DNA extraction

[0036] (1) Statically culture T.thermosaccharolyticum DSM57124h, tak...

Embodiment 2

[0049] Embodiment 2: Construction of recombinant plasmid pET-BGL-CBD

[0050] 2.1 Genomic DNA of Clostridium cellulovorans 743B

[0051] C.cellulovorans743B genomic DNA was directly purchased from DSMZ Culture Collection Center (www.dsmz.de) number 3052.

[0052] 2.2 Construction of recombinant plasmid pET-BGL-CBD

[0053] Primers were designed according to the known gene sequence of C.cellulovorans743B cellulose-binding domain (CBD) (accession number: ZP_07630535.1), and the primers were synthesized by Shanghai Bioengineering Co., Ltd. P3: CCC GGATCC CCACCACCAATGTCAGTTGAATTTTACAA, the underline represents the BamH I site, and the italics represent the connecting peptide added, the function of the connecting peptide is to functionally connect the cellulose-binding domain and the high-glucose-resistant β-glucosidase (Progress in Natural Science, 2008, 18(7 ):742-745). P4: CCC CTCGAG TGGTGCTGTACCAAGAACT, Xho I site underlined. Using the purchased C.cellulovorans743B geno...

Embodiment 3

[0055] Example 3: Preparation of recombinant fusion enzyme (BGL-CBD)

[0056] The recombinant plasmid pET-BGL-CBD was transformed into Escherichia coli JM109 (DE3) host bacteria (Novagen), on the LB plate containing ampicillin (50μg / mL) (LB medium: tryptone 10g / L, yeast extract 5g / L , NaCl 5g / L, agar 15g / L) after culturing overnight at 37°C, pick the transformants into 200mL LB medium (50μg / mL ampicillin) at 37°C, shaking at 200rpm until OD 600 When the concentration is 0.6, add a final concentration of 0.5mM isopropyl β-D-thiogalactopyranoside (IPTG) inducer, culture at 30°C for 6h, and use a high-speed refrigerated centrifuge to cool the culture medium at 4°C at 13,000 Centrifuge at rpm for 15 min to collect the cells.

[0057] Since the recombinant plasmid pET-BGL-CBD contains the His-tag tag, the purified recombinant enzyme was purified by His·Bind Purification Kit (Novagen). The specific operation process:

[0058] A. Processing of samples

[0059] (1) Resuspend the w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a high glucose resistance beta-glucosidase-CBD fusion enzyme, and expression gene and application thereof. The amino acid sequence is shown as SEQ ID NO. 1. Compared with the conventional beta-glucosidase enzyme, the fusion enzyme (BGL-CBD) provided by the present invention has the following characteristics: (1) higher cellulose binding ability, wherein the fusion enzyme (1 [mu]g / [mu]L) is incubated with 4 wt% of microcrystalline cellulose for 30min, and 98% of fusion enzyme is adsorbed by cellulose; (2) effectively degrading cellobiose, wherein the degradation rate of 10 wt% of the cellobiose by the fusion enzyme (0.15 [mu]g / [mu]L) within 8 h is 95%; and (3) resistance for high concentration glucose, wherein the glucose tolerance factor Ki is 1000 mmol / L.

Description

technical field [0001] The invention belongs to the field of genetic engineering technology and biomass utilization, and specifically relates to the fusion of high sugar-resistant β-glucosidase and cellulose binding domain and the recombinant expression and application of the gene. Background technique [0002] With the improvement of people's production and living standards, energy, resources and environmental issues are increasingly concerned. The use of agricultural and forestry waste to prepare bio-energy, the improvement of the quality of agricultural and forestry products through biotechnology, and the increase of added value of products have become the focus of scientists. The promise of a green economy. β-glucosidase (β-glucosidase, EC3.2.1.21), also known as β-D-glucoside hydrolase, gentiobiase, cellobiase, amygdalase, is a kind of enzyme that can catalyze the hydrolysis of aromatic glycosidic bonds between radicals or hydrocarbon groups and sugar radicals (Science...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/63C12N15/66C12N1/21C12P19/14C12R1/19
Inventor裴建军庞倩赵林果王飞
OwnerNANJING FORESTRY UNIV