Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting neisseria gonorrheae (NG)

A detection kit and technology for Neisseria gonorrhoeae, applied in the direction of microbial determination/inspection, fluorescence/phosphorescence, biochemical equipment and methods, etc., can solve the problems of lack of quality control system and low detection sensitivity of the kit, and achieve a simple and efficient method. The effect of high detection sensitivity and wide detection range

Inactive Publication Date: 2013-04-24
SANSURE BIOTECH INC
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] At present, kits for detecting NG-DNA based on real-time fluorescent quantitative PCR technology have been used in clinical detection at home and abroad, but most of these kits use the boiling method to extract nucleic acid, and the detection sensitivity is not high, about 500~1000copies / ml ; In addition, most of these kits lack a complete quality control system, and further improvement and improvement of the technical level are needed to make such products more meet the needs of clinical and accurate diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting neisseria gonorrheae (NG)
  • Kit for detecting neisseria gonorrheae (NG)
  • Kit for detecting neisseria gonorrheae (NG)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] The present embodiment provides a specific gonorrhea fluorescent PCR detection kit, which includes the following components:

[0027] ①Nucleic acid release agent: contains 0.1mM / L of surfactin, 100mM / L of potassium chloride, 0.1% of sodium dodecylsulfonate (SDS), and 0.1% of ethanol.

[0028] ②Internal standard (positive internal control): It is a recombinant of a 97 base pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, the concentration is 5.00E+05copies / ml, and the sequence of 97 base pairs is: 5'-GTGTCTGCGGCGTTTTATCATCATCTTCCTCTGTCATCCAGTGCAAGTCTTGATCCTGTCGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGT-3'.

[0029] ③PCR reaction solution: including 5 μl of 10×PCR reaction buffer, 0.2 mmol / L dNTP, 0.3 μmol / L upstream and downstream primers for target polynucleotide amplification, and 0.3 μmol / L probe for target polynucleotide detection The upstream and downstream primers used for internal standard fragment amplification are bot...

Embodiment 2

[0035] This embodiment provides the operation steps of the kit described in the above-mentioned embodiment 1 for detecting NG-DNA in unknown samples such as genital secretions:

[0036] 1. Reagent preparation

[0037] According to the number of samples to be tested, NG negative control, NG positive control and NG quantitative reference products A~D, take the corresponding amount of PCR reaction solution (38 μl / person), enzyme mixture solution (2 μl / person) and content in proportion. Label 1.0 μl / person and mix thoroughly to form a PCR-mix. For example, when the sample to be tested is 3 people, a total of 9 people need to be prepared (the number of people in the above four is 3, 1, 1 and 4 respectively). PCR-mix; ready for use after brief centrifugation.

[0038] 2. Sample processing

[0039] 1. Method A: Rapid nucleic acid release directly from the sample

[0040] Add 2 to 5 μl of nucleic acid release agent into each PCR reaction tube (it is recommended to inhale deeply and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for detecting neisseria gonorrheae (NG). The kit comprises a nucleic acid releaser and a PCR (Polymerase Chain Reaction) solution, wherein the nucleic acid releaser comprises 0.01-0.5mM / L of surfactin, 20-300mM / L of potassium chloride, 0.01-2% of sodium dodecyl sulfate and 0.05-1% of ethanol; and the PCR solution comprises a forward primer and a reverse primer which are used for amplifying targeted polynucleotide, and a probe for detecting the targeted polynucleotide. A method of releasing nucleic acid by using the nucleic acid releaser in the kit provided by the invention is not obviously different from a boiling method in the detection result, and a violent protein denaturant adopted for the nucleic acid extraction in the method provided by the invention quickly breaks a coat protein structure of a pathogen to release pathogen nucleic acid, so the release and extraction of DNA (Deoxyribonucleic Acid) can be realized without heating; besides, the sensitivity of the provided kit for detecting the NG can be 400 copies / ml, the linearity region of the detection is 400-4.00E+10 copies / ml; and moreover, NG-DNA in an unknown sample such as genital secretions can be quickly and precisely detected by using the kit, so a reliable experiment basis is provided for diagnosing NG infection.

Description

technical field [0001] The invention provides a gonorrhea (NG) detection kit, in particular a fluorescent PCR-based NG-DNA detection kit. Background technique [0002] Neisseria gonorrhea (NG) was discovered by Neisser in 1879, commonly known as Neisseria gonorrhoeae or Neisseria gonorrhoeae, is the causative pathogen of human gonorrhea, belonging to the genus Neisseria. Neisseria gonorrhoeae (NG) is strictly parasitic to humans, and has a strong ability to adapt and invade the human body. Its main pathogenic substances include pili, outer membrane protein, protease, lipopolysaccharide, etc. It is a disease with a high incidence in developing countries. one of the sexually transmitted diseases. NG is mainly directly infected through sexual contact, can also be indirectly infected through contact with the patient's clothing or toilet, and can also infect the fetus during delivery through the birth canal. [0003] Gonorrhea is one of the most common STDs in the world. It is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/06G01N21/64
Inventor 戴立忠邓中平李勃
Owner SANSURE BIOTECH INC
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More