Engineering bacteria for producing 1,3-propylene glycol and method for constructing same

A construction method and technology of engineering bacteria, applied in the field of engineering bacteria producing 1,3-propanediol and its construction, can solve problems such as unknown impact, achieve the effects of reducing toxic effects, reducing production costs, and reducing types of by-products

Active Publication Date: 2013-06-12
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF6 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the inactivation of the key coding genes of the acetic acid metabolic pathway, and the effect of the inactivation of the acetic acid metabolic pathway on the production of 1,3-propanediol by Klebsiella fermentation is unknown.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria for producing 1,3-propylene glycol and method for constructing same
  • Engineering bacteria for producing 1,3-propylene glycol and method for constructing same
  • Engineering bacteria for producing 1,3-propylene glycol and method for constructing same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Construction of a Klebsiella pneumoniae mutant strain in which the phosphotransacetylase gene, a key gene in the acetic acid metabolic pathway, is inactivated.

[0026] (1), cloning of phosphotransacetylase gene PTA partial sequence

[0027] Primers were designed according to the complete DNA sequence of the phosphotransacetylase gene PTA (GenBank number: YP_002920553.1), and its partial homologous sequence was amplified by PCR. The primer sequences were as follows: upstream primer PTA-F: TACCCGGGTACCAGCGTAGGTCTGACCAGCGTC and downstream primer PAT-R: GACCCGGGTTACTTCTGCTGCTGAGCCGATTG . Using wild-type Klebsiella pneumoniae (preserved in China Center for Type Culture Collection, deposit number: CCTCC M 2011075) genomic DNA as a template, under the guidance of primers PTA-F and PAT-R, PCR amplified phosphotransfer For the partial sequence of the acetylase gene PTA, the PCR amplification conditions are as follows: first 95°C for 3 minutes; then 94°C for 1 minute...

Embodiment 2

[0032] Example 2: Detection of the activity of the Klebsiella pneumoniae mutant strain in which the phosphotransacetylase gene was inactivated.

[0033] The Klebsiella pneumoniae mutant strain in which the phosphotransacetylase gene was inactivated in Example 1 is detected for the activity of phosphotransacetylase, and the wild-type Klebsiella pneumoniae is used as a control. The specific method includes the following steps:

[0034] (1) Inoculate the Klebsiella pneumoniae mutant strain in which the phosphotransacetylase gene is inactivated into 100 mL of culture medium (every liter of water contains 10 g of glycerol, 10 g of tryptone, 5 g of yeast powder, 5 g of NaCl, pH 7.0, 120° C. Sterilize for 20 minutes), shake and culture at 37°C for 6-12 hours, and collect bacteria by sampling and centrifuging every 2 hours;

[0035] (2) Suspend and wash the bacteria twice with 100mL phosphate buffer (0.1M, pH7.5);

[0036] (3) Suspend the bacteria with 2.5mL phosphate buffer (0.1M, p...

Embodiment 3

[0040] Example 3: Fermentative production of 1,3-propanediol by Klebsiella pneumoniae mutant strain with inactivated phosphotransacetylase gene

[0041] (1) culture medium

[0042] LB medium (g·L -1 ): yeast powder 5, peptone 10, NaCl10, agar 10, adjusted to pH 7.0, for short-term preservation and activation of Klebsiella species. The composition of seeds and fermentation medium is shown in Table 1:

[0043] Table 1: Medium Composition

[0044]

[0045] (2) Training method

[0046] (i) Seed activation: the Klebsiella pneumoniae mutant strain in which the phosphotransacetylase gene in Example 1 preserved from the glycerol tube was inoculated to the LB medium slant for activation, and the temperature was cultivated at 37° C. for 12 hours to activate the seeds .

[0047] (ii) Seed culture: 250mL triangular flask sealed with 9 layers of gauze, filled with 100mL of seed culture medium, connected to the slant lawn (activated seeds of step i), and carried out aerobic seed cul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an engineering bacteria for producing 1,3-propylene glycol and a method for constructing the same. The invention silences the phosphate transacetylase genes in a wild type strain producing 1,3-propylene glycol by utilizing a homologous recombination method and a gene insertional inactivation method so as to obtain a genetically engineered bacterium, of which the acetic acid metabolic pathway is blocked. When the 1,3-propylene glycol is fermented and produced by the engineering bacteria disclosed by the invention, the acetic acid production is largely reduced, the toxic action on cells caused by the by-product acetic acid is greatly decreased and the production rate of biomass per unit is enhanced. Moreover, the post-extracting process is simplified and the production cost is reduced as the species of the by-products are reduced. The experiments prove that the concentration of the 1,3-propylene glycol can reach more than 55g / L by fermenting the engineering bacteria provided by the invention for 28 hours according to a conventional method. The invention plays an important role in the industrial production for producing 1,3-propylene glycol by a microbiological fermentation method and has a wide application prospect.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an engineering bacterium producing 1,3-propanediol and a construction method thereof. Background technique: [0002] 1,3-Propanediol (PDO) is an important chemical raw material, which can be used as an organic solvent in high pressure lubricants, dyes, inks, antifreeze and other industries. PDO can be used to synthesize heterocycles, drug intermediates, polyesters and polyurethanes, especially as a monomer for polyester PTT. PTT is a new fiber-forming polyester polymer material that has achieved industrial scale after polyethylene terephthalate (PET) in the 1950s and polybutylene terephthalate (PBT) in the 1970s. A very promising new polyester material. In 1998, PTT was rated as one of the six new petrochemical products by the United States. Compared with PET and PBT, PTT not only has the chemical resistance of polyester, but also has other more excellent characteristi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/74C12N1/21C12P7/18C12R1/22
Inventor周胜秦启伟魏京广李莉莉付静
OwnerSOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI