Novel beta-glucosidase, coding gene thereof and applications thereof

A technology of application and glycosidic bond, applied in the direction of glycosylase, genetic engineering, plant genetic improvement, etc., can solve the problems of reducing industrial production cost and insufficient yield

Active Publication Date: 2014-02-12
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF8 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current production of β-glucosidase in industry is still far from enough, so it is necessary to further expand the screening objects, from which new β-glucosidases with higher enzyme activity and more diversified physical and chemical properties are screened out, and efficient Secreted expression to reduce industrial production costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel beta-glucosidase, coding gene thereof and applications thereof
  • Novel beta-glucosidase, coding gene thereof and applications thereof
  • Novel beta-glucosidase, coding gene thereof and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0121] Embodiment 1, the isolation of β-glucosidase and its coding gene

[0122] At 37°C, culture Aspergillus terreus (NIH2624, purchased from the American Type Culture Collection) for 2 days with cellulose-containing Chapei medium, extract RNA, and then reverse-transcribe it into cDNA, search through the Aspergillus terreus genome database bgls gene number Gene: ATEG_07931 (http: / / www.cadre-genomes.org.uk / Aspergillus_terreus), using cDNA as a template, using polymerase chain reaction to separate and synthesize double-stranded DNA, the isolated gene has SEQ ID NO: The nucleotide sequence of 1 is the bgls coding sequence. From the 1st to 2211th nucleotides of the 5' end of SEQ ID NO:1 is the open reading frame (Open Reading Frame, ORF) of bgls, from the 1st-3rd nucleotides of the 5' end of SEQ ID NO:1 It is the initiation codon ATG of the bgls gene, and the 2209th to 2211th nucleotides from the 5' end of SEQ ID NO: 1 are the termination codon TGA of the bgls gene.

[0123]The...

Embodiment 2

[0125] Embodiment 2, secretory expression of bgls in host Trichoderma reesei

[0126] 1. Host modification for optimized expression of bgls

[0127] Site-directed mutation was performed on the cbh1 promoter (SEQ ID NO: 13) of Trichoderma strain RC30-8 (see Microbial Cell Factories, 2012, 11:21). There are three carbon metabolism repressor (CCR) protein Cre1 binding sites (5'-SYGGRG-3' or its complementary sequence) in the cbh1 promoter, resulting in insufficient expression intensity under glucose repression conditions. In the first round of mutation, the Cre1 binding site at -724 was transformed into the binding site of the transcriptional activator Ace2 (5'-GGCTAA-3') by point mutation; in the second round of mutation, -698 and Both CRE1 binding sites at -690 were mutated into the binding site of Hap protein complex (5'-CCAAT-3'), and the mutant promoter pchb1m2 (SEQ ID NO: 14) was obtained. Taking eGFP as the reporter gene, it was found that after the promoter was mutated ...

Embodiment 3

[0139] Example 3, secretory expression of bgls in host Pichia pastoris

[0140] 1. Construction of recombinant expression vector in host Pichia pastoris

[0141] The gene isolated from the above by PCR is used as a template to clone the β-glucosidase ORF coding gene (except for the signal peptide coding sequence), and the forward primer used is: 5'AT ATCGAT TCTGACCACCTGGGACGCGGC3'(SEQ ID NO:6), Cla I recognition site added to its 5' end: ATCGAT; reverse primer is 5'GC TCTAGA GGAACAGTAAAAGACCCATCC3' (SEQ ID NO: 7), with an Xba I recognition site added to its 5' end: TCTAGA.

[0142] After the PCR product was purified, it was digested with Cla I and Xba I, and the digested DNA fragment was recovered using the Axygen PCR Product Column Recovery Kit. The DNA fragment and the recovered vector pPICZαC (purchased from Invitrogen) , were ligated overnight at 16°C with T4 DNA ligase to obtain the recombinant expression vector pPICZαC-ppbgls. The C-terminus of the expression produc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention related to a novel beta-glucosidase, a coding gene thereof and efficient heterogeneous expression thereof. The invention also relates to a coding-gene-contained expression vector and a coding-gene-contained host cell. The invention also relates to a host cell expressing the coding gene and induction culture conditions thereof. The invention also relates to a method of hydrolyzing a cellobiose which is produced during cellulose degradation by the beta-glucosidase into glucose. The beta-glucosidase has characteristics of good stability and high activity under weak acid conditions, and can be applied for industrial production.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a new β-glucosidase, its coding gene, application, and high-efficiency heterologous expression thereof. Background technique [0002] Cellulose is a polymer composed of multiple glucose residues linked by β-1,4-glycosidic chains, and is the most abundant renewable biomass resource on earth. Using lignocellulose as raw material, hydrolyzing cellulose with cellulase to generate glucose, and then fermenting it into fuel ethanol has become an important way to deal with the problems of energy crisis and environmental pollution in the world today. [0003] Cellulase refers to the general term for a series of enzymes that can convert cellulose into glucose, mainly including endo-β-1,4-glucanase (EC 3.2.1.4), exoglucanase (exoglucanase, EC 3.2.1.91) and β-glucosidase (β-glucosidase, EC 3.2.1.21). Endoglucanase acts on the inside of the long-chain cellulose molecule to cut the long fiber into...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12P19/14C12P33/20C12P17/06C12P7/22C12P7/10A23L1/22A23L27/00
CPCY02E50/16C12N9/2445C12P19/14C12Y302/01021Y02E50/10
Inventor周志华邹根严兴魏维陈玲张珺王成树
OwnerCAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI