Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for changing phosphorylation site of rice phosphate transporter gene OsPT8 and application thereof

A technology of transporter and phosphate, applied in the field of genetic engineering and crop genetic improvement, can solve the problems of hindering the normal output of PHT1 protein and affecting the effective accumulation.

Inactive Publication Date: 2014-03-05
ZHEJIANG UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If the PHT1 protein is phosphorylated, it is equivalent to adding an additional negative charge near the ER export recognition motif, which may directly affect the recognition of the motif and hinder the normal export of PHT1 protein from the ER
When the external phosphorus supply level is high, the degree of phosphorylation modification of PHT1;1 protein is increased, which may affect its effective accumulation on the plasma membrane

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for changing phosphorylation site of rice phosphate transporter gene OsPT8 and application thereof
  • Method for changing phosphorylation site of rice phosphate transporter gene OsPT8 and application thereof
  • Method for changing phosphorylation site of rice phosphate transporter gene OsPT8 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1, OsPT8 site-directed mutation

[0046] 1. Search for possible phosphorylation sites: Download 9 PHT family members of Arabidopsis and 13 homologous proteins of rice from NCBI for sequence alignment ( figure 1 ), it was found that the 517th and 512th serines of OsPT8 (SEQ ID NO: 1) amino acids are the most likely homologous sites to the 514th serines of Arabidopsis PHT1;1.

[0047] 2. Primer design for site-directed mutagenesis: Due to the different codon preferences of proteins of different species, the Editseq software of DNASTAR Company was used to count the codons encoding alanine in OsPT8, and found that GCG in OsPT8 was the main alanine codon. Mutation of PT8Ser-517 to GCG(Ala) was therefore chosen. By designing primers with mutated bases, the primer sequences are as follows:

[0048] Table 1. Primers for point mutation of OsPT8 protein Ser

[0049] Primer name

Primer sequence (5'-3')

PT8A-P1

GCTCTAGAGCGCGGCAGGAGCAGCAGCAGCA ...

Embodiment 2

[0080] Embodiment 2, vector construction and transgene

[0081] 1. Construction of the binary vector: Design primers PT8A-CDS-SalI-low and PT8A-CDS-SalI-up (Table 2) according to the CDS sequence of the OsPT8 gene, and introduce EcoR I and Sal I restriction sites (underlined ), using pCAMBIA1300-35S-OsPT8 in Example 1 S517A -GFP plasmid was used as a template to amplify OsPT8 S517A gene sequence.

[0082] The PCR reaction system is 50μl, including 100ng of DNA template, 1μl of each 10mM primer pair, 5μl of 10×PCR buffer, 5μl of 2mM dNTP mixture, 25mM MgCl 2 4 μl, add ddH 2 O to a total volume of 50 μl. The PCR amplification reaction program is: 1cycle (94°C, 10min), 29cycles (94°C, 1min; 58°C, 1min; 72°C, 1.5min), 1cycle (72°C, 5min). Amplified products were detected on 1.0% agarose gel.

[0083] Then use EcoR I and Sal I double enzyme digestion and connect into pCAMBIA1301-35S (see above for the construction method) to obtain 35S-1300-OsPT8 S517A . Use the OsPT8 promo...

Embodiment 3

[0090] Embodiment 3, available phosphorus analysis of transgenic positive strains

[0091] Take NIP wild type and transgenic positive line PT8 S517A 40 rice seeds of No. 1-3 strains were soaked at 37°C until they were white. The seeds of Lubai were sown in the nutrient solution with 100 M phosphorus concentration, and grown in the growth room (temperature 30°C during the day, 22°C at night, light 350mmol m- 2 S -1 ) After 7 days, five plants were transplanted into 10L of 100M phosphorus concentration nutrient solution (see Table 3 for formula), and continued to grow in the growth room (temperature 30°C during the day, 22°C at night, light 350mmol m- 2 the s -1 ) for 21 days, and the nutrient solution was replaced once in the middle. The other positive seedlings were harvested in the greenhouse and used to screen pure strains. After observing the phenotype, the shoots and roots were taken respectively (the roots were rinsed with deionized water, and finally blotted dry wit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for changing phosphorylation sites of a rice phosphate transporter gene OsPT8. The method is as below: carrying out genetic engineering modification on possible phosphorylation sites of the OsPT8 protein sequence; mutating 517th amino acid residue serine (Ser) into alanine (Ala), so as to obtain the modified Ospt8 gene sequence. The invention also discloses a method for improving the ability of phosphorus absorption of rice. The modified Ospt8 gene sequence is transferred into rice, and the obtained transgenic rice gains enhanced ability of absorption on phosphorus. The method is specifically as below: the modified Ospt8 gene sequence is started by using its own promoters and transferred to rice through a transgenic approach.

Description

technical field [0001] The invention belongs to the field of genetic engineering and crop genetic improvement. Specifically, the present invention relates to a method of genetically engineering changes to the 517th amino acid residue serine (Ser) and other possible phosphorylation sites of the rice phosphate transporter OsPT8 protein sequence. The phosphorus uptake capacity of rice can be changed after the modified Ospt8 gene is transgenic through its own promoter. Background technique [0002] The phosphate (Pi) transporter PHT1 is a membrane-bound protein. PHT1 protein enters the endoplasmic reticulum (Reticulum, ER), inserts into the membrane in the appropriate direction (the N-terminal and C-terminal are always positioned towards the cytoplasm during the system movement), and undergoes correct conformational folding and modification to form a membrane vesicle (Vesicle) reaches the plasma membrane via the Golgi apparatus. It can be seen that the activity of the Pi tran...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82A01H5/00
CPCC07K14/415Y02A40/146C12N15/8261G01N33/68G01N2333/415G01N2440/14
Inventor 吴平徐纪明陈婕妤王以锋
Owner ZHEJIANG UNIV