Cell line of dengue virus type-2 replicor with dual-reporter gene and application
A dual-reporter gene and dengue virus technology, applied to cells modified by introducing foreign genetic material, microbial-based methods, and resistance to vector-borne diseases, etc., to achieve obvious sensitivity and high efficiency, shorten the development cycle, and eliminate potential dangers Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] The pACYC-TSV-Rluc2A-Rep-3NTR-IR ES-Neo replicon plasmid construction with luciferase (Rluc) and neomycin phosphotransferase (Neo), the steps are:
[0049] (1) Using fusion PCR technology, in the DENV2 replicon pACYC-DENV2-TSV-Rluc2A-Re p with Rluc (source: Development and characterization of a stable luciferase dengue virus for high-t throughput screening[J].Antiviral research, 2011, 91(1):11-19.) to construct the C9250G mutation to create the Nhe1 restriction site.
[0050] ①The pACYC-DENV2-TSV-Rluc2A-Rep plasmid was double-digested with XhoI and CalI, and the DENV2-TSV-F gene fragment was obtained after gel recovery of the digested product; F (A AAACCGGTTGAATGCATTG) and primer-NheⅠ-R (GGGGCTCACAGCTAGCATAGTTTT TTCCG) PCR amplification of the DENV2-TSV-AgeⅠ-NheⅠ gene fragment. The PCR reaction system is: 5×PS buffer (T aKaRa): 10 μl, dNTP: 2 μl, primer primer-AgeⅠ-F (10uM) (AAAACCGGTTGAATGCATTG): 1 μl, primer primer-NheⅠ-R (10uM) (GGGGCTCACAGCTAGCATAGTTTTTTCCG): 1 μl,...
Embodiment 2
[0057] The pACYC-TSV-Rluc2A-Rep-3NTR-IRES-Neo replicon plasmid successfully rescued the replicon with replication ability and high-efficiency expression of luciferase and neomycin phosphotransferase genes. The steps are:
[0058] (1) Preparation of pACYC-DENV2-TSV-Rluc2A-Rep-3NTR-IRES-Neo RNA:
[0059] ①Plasmid linearization and phenol-chloroform extraction: Take 10 μg each of plasmid pACYC-DENV2-TSV-Rluc2A-Rep-3N TR-IRES-Neo and plasmid pACYC-DENV2-TSV-Rluc2A-Rep, digest with ClaⅠ, 37°C Enzyme digestion for two hours, after 1% agarose gel electrophoresis to identify the complete digestion, add 100 μl saturated phenol (purchased from Sinopharm Chemical Reagent Company) to the digested product, shake and mix, centrifuge at 17000g for 5min, absorb the upper liquid in Into a new centrifuge tube, add 100 μl sterile water to the original centrifuge tube, shake and mix, centrifuge at 17,000 g for 5 minutes; absorb the upper layer liquid and combine it with the liquid obtained in the...
Embodiment 3
[0067] A cell line with a dengue virus type 2 replicon with double reporter genes, the screening process is as follows:
[0068] (1) Determination of the optimal concentration of antibiotic G418 for screening cell lines:
[0069] In each well of a 24-well cell culture plate, 2×10 4 After 24 hours, the culture medium in the wells was sucked and discarded, and 0.5ml of DMEM medium containing 10% FBS (purchased from Gibco, USA) was inserted into the wells, and G418 was added to each well at the same time, and the final concentrations were respectively 0, 200, 400, 600, 700, 800 and 1000 μg / ml, two replicates for each concentration, culture in an incubator at 37°C, 5% (v / v) CO2, and discard the medium in the well after 72 hours , insert 0.5ml of DMEM medium containing 10% FBS (purchased from Gibco, USA), and add G418 to each well at the same time, the final concentrations are 0, 200, 400, 600, 700, 800 and 1000μg / ml Each concentration was repeated twice, cultured in an incubator...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com