Recombinant high-temperature pullulanase and preparation method thereof

A technology of pullulanase and high temperature, which is applied in the field of bioengineering, can solve the problem that proteins cannot be folded into mature proteins with correct conformation, etc., and achieve the effects of reducing saccharification time, high biological activity and improving saccharification efficiency

Inactive Publication Date: 2014-06-04
YANGTZE UNIVERSITY
View PDF4 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, the most mature choice for exogenous gene expression is the E. coli expression system, and the plasmid with the T7 promoter is the most selected expression vector, such as the commercialized pET series; When down-induced expression, because the transcription rate of the gene is too fast, the newly synthesized protein has no time to fold into a mature protein with the correct conformation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant high-temperature pullulanase and preparation method thereof
  • Recombinant high-temperature pullulanase and preparation method thereof
  • Recombinant high-temperature pullulanase and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1: Construction of high-temperature pullulanase engineering bacteria and expression of its enzyme

[0065] 1. Primer design and PCR method to obtain high-temperature pullulanase target gene and preparation of recombinant vector

[0066] The genome of Thermus scotoductus SA-01 strain has a predicted sequence that may encode a pullulanase gene. The selected nucleotide sequence is shown in the sequence table SEQ ID NO: 1, and the gene is named pullu. The gene of the enzyme is amplified from the genome DNA of Thermus scotoductus SA-01 bacteria by PCR method. Primers were designed according to the gene sequence and restriction enzyme sites in the vector, and were commissioned to be synthesized by Beijing Aoke Dingsheng Biotechnology Co., Ltd. Upstream primer: 5'ATG CCATGG CCTGGTACGAGGGCGCTTTCTT’, the underlined part is the restriction site of NcoI; downstream primer: 5’CCG CTCGAGG ACCTCCACCCAGATGGCCACG3', the underlined part is the restriction site of Xho I; the...

Embodiment 2

[0077] Embodiment 2: Activity analysis of recombinant high-temperature pullulanase

[0078] Recombinant high-temperature pullulanase activity was analyzed by DNS method: at pH 6.5, 70°C, 500 μL reaction system included: 250 μL 1% pullulan substrate (g / 100mL) and 240 μL buffer (50mM) preheated After 10 minutes, add 10 μL of appropriately diluted enzyme solution to react for 5 minutes, add 750 μL of DNS to terminate the reaction, cook in boiling water for 5 minutes, measure the OD value at 540 nm after cooling, and use glucose as the standard curve to calculate the enzyme activity. One enzyme activity unit (U) is defined as the amount of enzyme required to degrade 1% pullulan solution per minute and release 1 μmol of reducing sugar under given conditions.

Embodiment 3

[0079] Example 3: Determination of the properties of recombinant high-temperature pullulanase

[0080] 1. The method for determining the optimum pH and pH stability of the recombinant high-temperature pullulanase is as follows: the recombinant high-temperature pullulanase purified in Example 1 is subjected to enzymatic reactions at different pHs to determine its optimum pH. Using 0.5% pullulan as a substrate, using the reaction system in Example 2, 50 mM potassium hydrogen phthalate-imidazole buffer solution with different pH was used to measure pullulanase activity at 65°C. The result is as figure 2 Shown, show that the optimum pH of pullulanase is 6.5. High-temperature pullulanase was treated at 70°C for 60min in the above-mentioned different pH buffers, and then the residual enzyme activity was measured at 70°C to study the pH stability of the enzyme. The result is as image 3 As shown, it shows that the high-temperature pullulanase is stable in the range of pH 6-8, and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant high-temperature pullulanase and a preparation method thereof, belonging to the field of bioengineering technology. The invention is characterized in that a gene coding the high-temperature pullulanase is loaded on a pHsh expression vector and is then transferred to an Escherichia coli host for enlarged culture of an engineering bacterium containing the high-temperature pullulanase, then ultrasonic fragmentation and heating are carried out to remove most impurity proteins autonomously expressed by Escherichia coli, then the high-temperature pullulanase is prepared through affinity chromatographic separation and purification, and the recombinant high-temperature pullulanase has an optimal reaction temperature as high as 70 DEG C and a wide pH value application range and performs good catalytic activity at a high temperature of 70 to 80 DEG C, which enables the pullulanase to be especially suitable for cooperative usage with amylase and glucoamylase in the industry of production of sugar from starch and allows saccharification time to be reduced and saccharification efficiency to be improved. The recombinant high-temperature pullulanase provided by the invention is widely applicable to industries like food, wine brewing, feeds, medicine, papermaking and weaving.

Description

Technical field: [0001] The invention relates to a recombinant high-temperature pullulanase and a preparation method thereof, belonging to the technical field of bioengineering. Background technique: [0002] Pullulan is a linear polysaccharide composed of maltotriose linked by α-1,6-glucosidic bonds. Pullulanase (EC3.2.1.41) is a debranching enzyme capable of specifically hydrolyzing α-1,6 glycosidic bonds in pullulan polysaccharides, glycogen, starch, amylopectin and other oligosaccharides ( debranching amylase). Pullulanase is usually divided into four types according to substrate specificity and hydrolysis products: Type I pullulanase, which can hydrolyze α-1,6 glycosidic bonds in pullulan polysaccharides and branched oligosaccharides Generate maltotriose and linear oligosaccharides; Type II pullulanase, which can hydrolyze both the α-1,6 glycosidic bonds in pullulan polysaccharides and the α-1,4 glycosidic bonds in other polysaccharides; new Pullulanase and isopulula...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/44C12N15/56C12N15/70
CPCC12N9/2457C12N15/70C12Y302/01041
Inventor吴华伟蔚鑫鑫吴光旭陈丽冰高立琼
OwnerYANGTZE UNIVERSITY