Method of shearing fusion protein by escherichia coli intracellular protease

A fusion protein and Escherichia coli technology, applied in the field of genetic engineering, can solve the problems of protein inactivity, expensive protease, and large economic burden

A fusion protein and Escherichia coli technology, applied in the field of genetic engineering, can solve the problems of protein inactivity, expensive protease, and large economic burden

CN103993030AInactive Publication Date: 2014-08-20NANJING NORMAL UNIVERSITY

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method of shearing fusion protein by escherichia coli intracellular protease
  • Method of shearing fusion protein by escherichia coli intracellular protease
  • Method of shearing fusion protein by escherichia coli intracellular protease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1. Construction of intracellular shear strain with TEV protease gene integrated into BL21(DE3) chromosome

[0055] A vector containing a resistance gene and a homologous fragment for homologous recombination is first constructed. Design primer R1077: 5'- GTTAACGAGCTC GAATTGGCCGCGGCGTTG-3', (SEQ ID NO. 1), the restriction sites HpaI and SacI are underlined; R1078: 5'- GAGCTC GAATTGACATAAGCCTG-3', (SEQ ID NO. 2), SacI is underlined. Using pBAD322 as a template, a 0.8kb gentamycin gene fragment was obtained by PCR amplification. The 0.8kb blunt end was cloned into the SnaBI site of pLS2429 to obtain the recombinant clone pLS2459. After pLS2459 was digested with KpnI-SaII, the 1.8kb fragment was cloned into the KpnI-SaII site of pR6KMCS to obtain recombinant clone pLS2460. pLS2460 uses the R6K replicon, so the host strain is BW25141. BL21(DE3) does not contain the Pir gene required for R6K replication, so the circular vector remains without background interfe...

Embodiment 2

[0061] Example 2. Construction of expression vectors

[0062] pLS912 is a fusion expression vector containing two fusion tags of His and MBP and a 1.5kb stuffer fragment, described in Reference 7. To remove the His tag fused to MBP, design primer P1901: 5'-GGG GAATTCATATG GAAGAAGGTAAACTGGTAATCTG-3', (SEQ ID NO. 11), the introduced EcoRI and NdeI restriction sites are underlined; P1902: 5'-GGG GGATCC AGC AGA TCT TTGTTATAAATC-3', (SEQ ID NO. 12), the introduced EcoRI site and the BglII restriction site contained in the amplified sequence are underlined. Using pLS912 as a template, a 0.4kb fragment was obtained by PCR amplification. After being digested with NdeI-BglII, it was ligated with a vector of 7.5kb pLS912 digested with NdeI-BglII, and the recombinant clone pLS1902 was obtained by screening. GAGAATCTTTATTTTCAGGGC is contained between the MBP fusion tag and the stuffing fragment, and its amino acid sequence is ENLYFQ↓G, and ↓ indicates the TEV restriction site. ...

Embodiment 3

[0064] Reality Example 3. Intracellular cleavage of MBP-GFP protein

[0065] Design primer RG3: 5'-GAA GGATCC AGCAAGGGCGAGGAGCTGTTC-3', (SEQ ID NO. 13), RG4: 5'-GAA CTCGAG CTTGTACAGCTCGTCCATGCC-3', (SEQ ID NO. 14), the introduced BamHI and XhoI restriction sites are underlined. Using plasmid pJOE4905.1 as a template, PCR amplification of 0.7kb GFP gene was obtained. After digestion with BamHI-XhoI, it was cloned into the BamHI-XhoI digestion site of pKS, and the digestion and sequencing were correct to obtain pLS2436. pLS2436 was digested with BamHI-XhoI, and a 0.7kb GFP gene fragment was recovered and cloned into pLS1902, which was digested with BamHI-XhoI to a 6.4kb vector to obtain the MBP-GFP fusion expression vector pLS2437. The 3' end of GFP is fused to the Histag on the vector, followed by a terminator to terminate expression. pLS2437 was transformed into BL21(DE3), and the expression was induced by 1 mM IPTG at 30°C, and the 69.1KD expression protein was obtaine...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method of separating a target protein by shearing a fusion protein by escherichia coli intracellular protease. Used host bacteria is obtained by integrating a TEV (tobacco etch virus) protease gene driven by a strong promoter T7 to escherichia coli expression host bacteria BL21(DE3) by virtue of a recombinant engineering method. An expression vector is obtained by cloning maltose-binding protein and stuffer fragment to the expression vector pET30(+). A target gene not containing a terminator replaces the stuff segment to obtain a target gene fusion expression vector, and the tail end of the fusion protein contains 6 histidines of the vector. After the expression vector is transformed to the host bacteria, under induction of isopropyl-beta-D-thiogalactoside, the fusion protein and the TEV protease based on a chromosome are expressed at the same time; the TEV is acted on an enzyme cutting site between the maltose-binding protein and the target protein for separating the target protein. According to the intracellular shearing method, steps of fusion protein separating, TEV enzyme digesting, and the like are omitted.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for cleaving fusion proteins by protease in Escherichia coli cells. Background technique [0002] The high expression of heterologous genes in E. coli to obtain a large amount of protein is one of the most common forms of obtaining protein drugs, gene function research and protein research. Due to differences between species of organisms, many heterologous proteins exist in insoluble forms when expressed in E. coli. Insoluble proteins exist in inclusion bodies and need to be treated with a strong ionic denaturant to release the protein for purification, and then renature it with a reducing agent after purification. The process of denaturation and renaturation can easily lead to the reduction or loss of protein activity because of the need for strong oxidants and reducing agents, which will directly lead to the weakening of the therapeutic effect of protein drugs and t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
20 Aug 2014
Publication
CN103993030A
IPC
C12N15/70; C12P21/06
Inventors
尚广东; 李玲