Natural antimicrobial peptide Alligatorin4 and application thereof
An antimicrobial peptide, a natural technology, applied in the field of biomedicine, can solve the problems of dissolution of cell contents, cell death, damage to cell membrane integrity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0012] Discovery of natural antimicrobial peptide Alligatorin4
[0013] Through searching, a gene sequence (XP_006037273.1) with a length of 519bp was found from the Chinese alligator genome data on the website of the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov) , the encoded polypeptide precursor consists of 172 amino acid residues. The gene and its encoded polypeptide precursor are respectively shown in SEQ ID NO: 2 and SEQ ID NO: 3:
[0014] atgcagacctgctgggtcatcctgctcctgcccctgctcggggcagccagcaccgagctg
[0015] M Q T C W V I L L L P L L G A A S T E L
[0016] cccacccctggcaccgacccaccacagctcacgccgacctacgcccaggccctggccacg
[0017] P T P G T D P P Q L T P T Y A Q A L A T
[0018] gccgtcgacgtctacaaccaagggcccggcgtggacttcgccttccggctcctggaggca
[0019] A V D V Y N Q G P G V D F A F R L L E A
[0020] gagtcccgggacgactgggacgcgagcacggatcccctgcggcagctggagttcaccctg
[0021] E S R D D W D A S T D P L R Q L E F T L
[0022] aaggagaccgagtgccccgtggg...
Embodiment 2
[0034] Chemical synthesis method of antimicrobial peptide Alligatorin4
[0035] (1) Synthesize the full sequence of Alligatorin4 with an automatic peptide synthesizer (433A, Applied Biosystems), and pass HPLC C 18 Desalting and purification by reverse phase column chromatography. (2) The molecular weight was determined by conventional matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF). (3) The purified Alligatorin4 was identified by high performance liquid chromatography (HPLC) with a purity >95%, its molecular weight was determined by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF, 4402.5Da), and its isoelectric point was 12.78 by isoelectric focusing electrophoresis , using an automatic amino acid sequencer to determine its amino acid sequence structure is consistent with the natural Alligatorin4.
Embodiment 3
[0037] Detection of antibacterial activity of antimicrobial peptide Alligatorin4
[0038] (1) Pick the test strains preserved on the slant (Escherichia coli ATCC25922, Pseudomonas aeruginosa ATCC27853 were purchased from the China Common Microorganism Culture Collection Management Center, and other strains were collected from the local hospital) and spread evenly on the MH solid medium (purchased from Qingdao Haibo Biotechnology Co., Ltd.) plate, place a sterilized filter paper sheet with a diameter of 0.5 cm on the surface of the culture medium, add dropwise 10 μl of Alligatorin 4 sample solution of 2 mg / ml dissolved in sterilized deionized water, Incubate upside down at 37°C for 18-20 hours, and observe whether the inhibition zone is formed or not. If the sample has antibacterial activity, a clear and transparent bacteriostatic zone will be formed around the filter paper, and the larger the bacteriostatic zone, the stronger the antibacterial activity of the sample. The resu...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap