Unlock instant, AI-driven research and patent intelligence for your innovation.

Natural antimicrobial peptide Alligatorin4 and application thereof

An antimicrobial peptide, a natural technology, applied in the field of biomedicine, can solve the problems of dissolution of cell contents, cell death, damage to cell membrane integrity, etc.

Active Publication Date: 2014-11-19
SUZHOU UNIV
View PDF0 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The bactericidal mechanism of most antimicrobial peptides is by acting on the phospholipid bilayer on the bacterial cell membrane, destroying the integrity of the cell membrane and forming a transmembrane channel on the cell membrane, resulting in the dissolution of the cell content and cell death

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Natural antimicrobial peptide Alligatorin4 and application thereof
  • Natural antimicrobial peptide Alligatorin4 and application thereof
  • Natural antimicrobial peptide Alligatorin4 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0012] Discovery of natural antimicrobial peptide Alligatorin4

[0013] Through searching, a gene sequence (XP_006037273.1) with a length of 519bp was found from the Chinese alligator genome data on the website of the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov) , the encoded polypeptide precursor consists of 172 amino acid residues. The gene and its encoded polypeptide precursor are respectively shown in SEQ ID NO: 2 and SEQ ID NO: 3:

[0014] atgcagacctgctgggtcatcctgctcctgcccctgctcggggcagccagcaccgagctg

[0015] M Q T C W V I L L L P L L G A A S T E L

[0016] cccacccctggcaccgacccaccacagctcacgccgacctacgcccaggccctggccacg

[0017] P T P G T D P P Q L T P T Y A Q A L A T

[0018] gccgtcgacgtctacaaccaagggcccggcgtggacttcgccttccggctcctggaggca

[0019] A V D V Y N Q G P G V D F A F R L L E A

[0020] gagtcccgggacgactgggacgcgagcacggatcccctgcggcagctggagttcaccctg

[0021] E S R D D W D A S T D P L R Q L E F T L

[0022] aaggagaccgagtgccccgtggg...

Embodiment 2

[0034] Chemical synthesis method of antimicrobial peptide Alligatorin4

[0035] (1) Synthesize the full sequence of Alligatorin4 with an automatic peptide synthesizer (433A, Applied Biosystems), and pass HPLC C 18 Desalting and purification by reverse phase column chromatography. (2) The molecular weight was determined by conventional matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF). (3) The purified Alligatorin4 was identified by high performance liquid chromatography (HPLC) with a purity >95%, its molecular weight was determined by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF, 4402.5Da), and its isoelectric point was 12.78 by isoelectric focusing electrophoresis , using an automatic amino acid sequencer to determine its amino acid sequence structure is consistent with the natural Alligatorin4.

Embodiment 3

[0037] Detection of antibacterial activity of antimicrobial peptide Alligatorin4

[0038] (1) Pick the test strains preserved on the slant (Escherichia coli ATCC25922, Pseudomonas aeruginosa ATCC27853 were purchased from the China Common Microorganism Culture Collection Management Center, and other strains were collected from the local hospital) and spread evenly on the MH solid medium (purchased from Qingdao Haibo Biotechnology Co., Ltd.) plate, place a sterilized filter paper sheet with a diameter of 0.5 cm on the surface of the culture medium, add dropwise 10 μl of Alligatorin 4 sample solution of 2 mg / ml dissolved in sterilized deionized water, Incubate upside down at 37°C for 18-20 hours, and observe whether the inhibition zone is formed or not. If the sample has antibacterial activity, a clear and transparent bacteriostatic zone will be formed around the filter paper, and the larger the bacteriostatic zone, the stronger the antibacterial activity of the sample. The resu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a natural antimicrobial peptide Alligatorin4 and an application thereof in the antimicrobial aspect. The antimicrobial peptide Alligatorin4 disclosed by the invention is derived from Alligator sinensis. The mature peptide sequence of the antimicrobial peptide is obtained by retrieving a gene database of the Alligator sinensis, screening and analyzing, and the amino acid sequence is as shown in SEQ ID NO. 1 in a sequence table. By comparative analysis, the natural antimicrobial peptide Alligatorin4 is obviously different from the amino acid sequences of all the existing antimicrobial peptides, and belongs to a novel antimicrobial peptide. Antimicrobial experimental results show that the antimicrobial peptide Alligatorin4 disclosed by the invention has very strong antimicrobial activity against Gram-positive bacteria, Gram-negative bacteria and fungi, has broad-spectrum and efficient antimicrobial effect, has the characteristics of low hemolytic activity, good salt tolerance, good heat tolerance, good heat stability and the like, and can be applied in preparation of medicines for resisting bacteria and inhibiting the growth of bacteria, preservatives, veterinary medicines, animal feeds and cosmetics.

Description

technical field [0001] The invention relates to a natural antibacterial peptide and its application, more specifically, to a natural antibacterial peptide Alligatorin4 derived from Chinese alligator and its application, belonging to the technical field of biomedicine. Background technique [0002] Traditional antibiotics have achieved remarkable results in the treatment of bacterial infections. However, in recent years, with the abuse of traditional antibiotics in the fields of medicine and aquaculture, microorganisms have become more and more resistant to traditional antibiotics. Some super bacteria with strong drug resistance have been eliminated, and the problem of microbial drug resistance has become a problem that seriously threatens human health. The response to microbial resistance has always been to use new or alternative antimicrobial agents that have not been used against drug-resistant microorganisms. Drug resistance, thus requiring the continuous development of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/46A61K38/17A61K8/64A61P31/04A61P31/10A61Q19/00A23K1/17A23L3/3526A23K20/195
CPCA61K38/00C07K14/46
Inventor 王义鹏于海宁高久香蔡莎莎
Owner SUZHOU UNIV