Unlock instant, AI-driven research and patent intelligence for your innovation.

Alpha-ketoacid decarboxylase KIVD-LL, and encoding gene and application thereof

A KIVD-LL, ketoacid decarboxylase technology, applied in the field of genetic engineering, to achieve the effect of high decarboxylation activity and great application potential

Inactive Publication Date: 2014-12-10
GUANGZHOU INST OF ENERGY CONVERSION - CHINESE ACAD OF SCI
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the best substrate of the known α-ketoacid decarboxylase is ketoisovalerate, the recombinant strain is more inclined to biosynthesis of isobutanol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alpha-ketoacid decarboxylase KIVD-LL, and encoding gene and application thereof
  • Alpha-ketoacid decarboxylase KIVD-LL, and encoding gene and application thereof
  • Alpha-ketoacid decarboxylase KIVD-LL, and encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Extraction of Lactococcus lactis subsp.Lactis genome:

[0040] Culture of Lactococcus lactis subsp.lactis:

[0041] Streak-inoculate the bacteria onto the MRS solid plate, culture at 37°C for 48 hours, pick a single colony in 2.5mL MRS liquid medium, culture overnight at 37°C and 200rpm.

[0042] Extraction of Lactococcus lactis subsp.Lactis genome:

[0043] (1) Bacterial culture was collected by centrifugation at 10,000 rpm for 1 min, and 180 μL of lysozyme was added, and digested at 37° C. for 2 h.

[0044] (2) Add 4 μL of endonuclease A (100 mg / mL) solution, shake for 15 s, place at room temperature for 5 min, add 20 μL of proteinase K solution into the tube, and mix evenly.

[0045] (3) Add 220 μL of buffer solution GB, invert and mix well, place in a metal bath at 70°C for 10 minutes, the original turbid solution becomes clear, and briefly centrifuge to remove the droplets on the tube wall;

[0046] (4) Add 220 μL of absolute ethanol to the EP tube, vo...

Embodiment 2

[0053] Example 2 Cloning of the gene kivd-LL encoding Lactococcus lactis subsp.Lactis α-ketoacid decarboxylase

[0054] According to the information of Lactococcus lactis α-ketoacid decarboxylase gene kivd in the NCBI database, primers Kivd-BF and Kivd-SR were designed to amplify the kivd-LL sequence using the genomic DNA of Lactococcus lactis as a template.

[0055] Kivd-BF: CG GGATCC GATGTATACAGTAGGAGATTACC

[0056] Kivd-SR: GC GTC GAC TTATGATTTATTTTGTTCAGC

[0057] The parameters of the PCR reaction were: denaturation at 94°C for 5 min; then denaturation at 94°C for 30 sec, annealing at 52°C for 30 sec, extension at 72°C for 2 min, a total of 30 cycles, and incubation at 72°C for 10 min. Obtain an about 1700bp fragment (its gel electrophoresis picture is as follows figure 2 shown), the fragment was recovered and connected to the pEASY-blunt zero vector to obtain the cloning vector pEASY-kivd-LL, which was sent to BGI for sequencing. Through BLAST comparison, it was ...

Embodiment 3

[0058] Example 3 Preparation and Purification of Recombinant α-Ketoacid Decarboxylase

[0059] The cloning vector pEASY-kivd-LL containing the α-ketoacid decarboxylase gene kvid-LL was digested with BamHI and SalI, and ligated with the expression vector pET28a(+) after the same digestion with T4DNA ligase, and the ligated product Transform E.coli Trans1-T1 competent cells, transform the positive clones into liquid medium for overnight culture, and extract the recombinant expression plasmid pET28a-kivd-LL (the plasmid construction model is shown in figure 1 As shown, its BamHI, Sal I double enzyme digestion electrophoresis is as follows image 3 shown).

[0060] The recombinant expression plasmid pET28a-kivd-LL was transformed into E.coli BL21(DE3) competent cells, and positive clones were screened on the resistant medium. Take the BL21(DE3) strain containing the recombinant plasmid pET28a-kivd-LL, inoculate it in 100mL LB liquid medium, culture it with shaking at 37°C and 20...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses alpha-ketoacid decarboxylase KIVD-LL, and an encoding gene and application thereof. The alpha-ketoacid decarboxylase KIVD-LL has the amino acid sequence of SEQ ID NO. 2. The encoding gene of the alpha-ketoacid decarboxylase KIVD-LL has the nucleotide sequence of SEQ ID NO. 1. Through a genetic engineering method, the alpha-ketoacid decarboxylase KIVD-LL with relatively decarboxylation activity on both alpha-ketoisovaleric acid and alpha-ketoisocaproic acid is obtained, and the enzyme has relatively great application potential in biosynthesis industry of isoamyl alcohol.

Description

Technical field: [0001] The invention belongs to the field of genetic engineering, and specifically relates to an α-ketoacid decarboxylase KIVD-LL, its coding gene and application. Background technique: [0002] Long-chain alcohols are not only an important chemical raw material for organic synthesis, but also considered as an emerging energy substitute. 3-methyl-1-butanone (isoamyl alcohol) is the main component of alcohol fermentation by-product "fusel oil", which has a very wide range of uses in chemical pharmaceuticals, solvents, flavors, organic synthesis and other industries. Isoamyl alcohol is a flavor that is allowed to be used in my country. It can also be used as a synthetic sedative and hypnotic, or it is a widely used organic solvent and chemical analysis reagent. In addition, as an emerging fuel, isoamyl alcohol has better fuel characteristics than ethanol, propanol, butanol, and n-isoalcohol. [0003] The synthesis of long-chain alcohols mainly includes biosy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N15/77C12N1/21C12P7/04C12R1/19C12R1/15C12R1/01
CPCC12N9/88C12P7/04C12Y401/01001C12Y401/01043C12Y401/01072C12Y401/01074
Inventor 袁振宏许敬亮陈小燕杨柳庄新姝张宇粱翠谊
Owner GUANGZHOU INST OF ENERGY CONVERSION - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com