Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction, expression and purification and functional identification of tissue plasminogen activator

A technology of plasminogen and activator, applied in the field of identification of the protein function, can solve the problems of intracranial hemorrhage, weak targeting, increase production cost, etc., and achieve the effect of improving the weak targeting

Inactive Publication Date: 2015-04-01
CHONGQING MEDICAL UNIVERSITY
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although tPA is an excellent thrombolytic drug, it also has weak targeting, which is easy to cause side effects such as intracranial hemorrhage, and most of the current production of tPA is expressed in inclusion bodies and then refolded, which makes the production process troublesome and increases the production cost.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction, expression and purification and functional identification of tissue plasminogen activator
  • Construction, expression and purification and functional identification of tissue plasminogen activator
  • Construction, expression and purification and functional identification of tissue plasminogen activator

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1 Construction of recombinant tissue-type plasminogen activator gene

[0019] The schematic diagram of the construction of the recombinant tissue plasminogen activator mutant is shown in figure 1 , the nucleotide and amino acid sequences are respectively shown in the sequence listing SEQ ID NO.1 and SEQ ID NO.2.

[0020] 1. Construct EST-tPA plasmid (a plasmid containing the full length of human tPA gene):

[0021] SEQ ID NO.3 (a total of 1584 bases in the nucleotide sequence):

[0022] SEQ ID NO.4 (the amino acid sequence has a total of 527 bases):

[0023] 2. Obtaining of recombinant rt-PA-m:

[0024] Design primers:

[0025] The upstream primer is: 5'- GGATCC ATG TCTTACCAAGTGATCTGCAGAGAT-3', BamHI cutting GGATCC, followed by the initiation codon ATG, the underlined part: CTGGAAGTTCTGTTCCAGGGGCCC is the 3C enzyme gene sequence, followed by the nitrogen terminal initiation sequence of the original tPA.

[0026] The downstream primer is: 5'- AAGCTT TT...

Embodiment 2

[0051] Example 2 Self-induced supernatant expression of expression plasmid in E. coli and purification of His-3C-tPA-RGDS protein

[0052] 1. Transformation of expression bacteria

[0053] The specific method is as follows: Take a tube of 50ul BL21(DE3) competent cells stored at -80°C and thaw on ice for 15 minutes; add 10 μl of the ligation product (His-3C-tPA-RGDS) to BL21(DE3) competent cells Mix gently, place on ice for 15 minutes; heat shock at 42°C for 1 minute, quickly place on ice, and ice bath for 15 minutes; add 100 μl non-resistant LB liquid medium, recover at 37°C at low speed (160rpm) for 45 minutes; Streak inoculation on ampicillin-resistant LB plates, and incubate in a 37°C incubator for 8-16 hours.

[0054] Transform the positive recombinant plasmid with correct sequencing into Escherichia coli BL21 (DE3) strain (commercially available, New England Biolabs (NEB) company article number: C2527H), streak inoculated on the ampicillin-resistant LB plate, and incuba...

Embodiment 3

[0071] Embodiment 3 tPA-RGDS thrombolytic activity identification

[0072] Preparation of fibrin plate; weigh 1g of agarose, add it to 100mL Tris-HCl buffer solution (composition: 50mM Tris-HCl, pH7.5, 100mM NaCl), sterilize by autoclaving at 115℃×10min, take 30ml of agar liquid Configure a plate, and when the temperature of the melted agar liquid drops to 37-42°C, add 1000 μL of 25 mg / mL fibrinogen mother solution and 1000 mM CaCl to it in turn. 2 300uL of mother solution, 500μL of 6.0IU / mL plasminogen mother solution, then incubate and shake at 37℃ for 30sec, then add 30μL of 100U / ml thrombin mother solution, incubate and shake at 37℃ for about 60-80sec, then turbidity can be seen; pour it into a plate immediately After 2 minutes, place the slightly solidified plate in a refrigerator at 4°C for about 10-20 minutes before use. ) Punch holes with a hole punch with a diameter of 3mm. The fusion protein and urokinase standard were diluted and added to each well, and incubated ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Construction of a recombinant tissue plasminogen activator (namely r-tPA) recombinant plasmid and a prokaryotic supernatant expression and purification method of the recombinant tissue plasminogen activator relate to construction, prokaryotic expression and purification technologies of tissue plasminogen activator recombinant plasmid. On the basis of full-length gene plasmid containing human tPA, a 3C sequence which can remove tags on the vector is introduced into a N end, a RGDS sequence which raises targeting is introduced into a C end, and PQE30 is used as a vector to construct a PQE30-rt-PA recombinant plasmid. Then, expression is induced by an autoinduction method. After bacteria crushing by an ultrasonic method, a Ni<2+> affinity column is used for r-tPA protein purification. PreScission protease is used for digesting 3C oligopeptide on the fusion protein, so as to remove a His-Tag. Finally, a molecular sieve is used for further purification so as to obtain high-purity r-tPA protein. The r-tPA protein is used for preparation of a thrombolytic drug with thrombus dissolution specificity.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the recombinant construction of human tissue-type plasminogen activator, the expression and purification technology of soluble supernatant obtained by prokaryotic Escherichia coli self-induction method, and the identification of the protein function. Background technique [0002] Coronary heart disease has become one of the leading causes of death and severe disability worldwide. Myocardial infarction is the most serious type of coronary heart disease. At present, the treatment of myocardial infarction mainly emphasizes opening the embolized blood vessels as soon as possible, restoring the blood perfusion of the myocardium, so as to save the dying myocardium, prevent the expansion of the infarct area or reduce the scope of myocardial ischemia, and protect and maintain the myocardial infarction. heart function. However, there are also complications such as intracranial hemorrhage aft...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12P21/02A61K38/16A61P7/02C12R1/19
Inventor 汪德强周建中龙小滨够怡然白垒黄爱龙张宏鹏杨可陈检
Owner CHONGQING MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com