Encoding mutation EPSPS (5-enolpyruvyl-shikimate-3-phosphate synthase) gene, and expression vector, expression product and application of encoding mutation EPSPS gene

A technology of CTP2-EPSPS and expression vectors, which is applied in the fields of encoded mutated EPSPS genes, its expression vectors, expression products and its applications, can solve the problems of large damage to crops, difficult selection of herbicides to eliminate weeds, etc., and achieve gene Less silencing, strong resistance to glyphosate, and low cost

Inactive Publication Date: 2015-11-18
HENAN ACAD OF AGRI SCI
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this kind of herbicide with strong activity on important farmland weeds is more harmful to crops. It is difficult to obtain the selectivity of herbicides to eliminate weeds and not harm crops. The cultivation and selection of herbicide-resistant varieties is the most fundamental and most effective. A convenient way to control weeds

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Encoding mutation EPSPS (5-enolpyruvyl-shikimate-3-phosphate synthase) gene, and expression vector, expression product and application of encoding mutation EPSPS gene
  • Encoding mutation EPSPS (5-enolpyruvyl-shikimate-3-phosphate synthase) gene, and expression vector, expression product and application of encoding mutation EPSPS gene
  • Encoding mutation EPSPS (5-enolpyruvyl-shikimate-3-phosphate synthase) gene, and expression vector, expression product and application of encoding mutation EPSPS gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 coding mutant EPSPS gene synthesis

[0040] On the basis of a large number of previous screening experiments, the bacterial culture screened and isolated the gene CP4- EPSPS (SEQ ID NO.1) was modified to replace the codons corresponding to the sequence with part of the codons, while excluding the commonly used restriction enzyme sites (SacI and XbaI), and then corrected and eliminated by replacing the codons, and in 3 Add a stop codon TAG to the end, and realize the amino acid mutation from the second serine to leucine by artificial synthesis, and obtain a modified mutation EPSPS Gene sequence (as shown in SEQIDNO.2), and its corresponding amino acid sequence as shown in SEQIDNO.3; In addition, in the transformed EPSPS The chloroplast guide peptide sequence of CTP2 (as shown in SEQ ID NO.4) is added in front of the 5 end of the gene to obtain the herbicide resistance gene CTP2- EPSPS (SEQ ID NO.5); then determine and chemically synthesize CTP2- EPSPS Cod...

Embodiment 2

[0086] Example 2 Plant expression vector pCAMBIA1300-CTP2- EPSPS Agrobacterium transformation of maize

[0087] In this experiment, Agrobacterium tumefaciens-mediated method was used to transfer the herbicide-resistant gene CTP2- EPSPS Fragment recombinant expression vector pCAMBIA1300-CTP2- EPSPS Introduce corn callus, and obtain transgenic seedlings after infection, recovery, selection, regeneration, hardening and other stages (see Figure 4 ). The specific steps are as follows:

[0088] (1) Preparation of immature embryos: Disinfect ears that have been pollinated for 10-14 days, take out the ears and wash them with sterilized water for 3 times, insert the tip of an embryo stripping knife between the embryo and endosperm, and gently pry out the immature embryos. Embryos, to ensure that the immature embryos are not damaged in any way (immature embryos with a size of about 1.5 mm are taken).

[0089] (2) Agrobacterium infection: Put the freshly stripped immature embryos...

Embodiment 3

[0095] Example 3 Molecular detection of transgenic maize plants

[0096] (1) PCR detection of transgenic maize plants

[0097] When the transformed plants grow 7-8 leaves, the leaves are taken to extract DNA, and PCR technology is used to detect exogenous genes. After flowering, the transgenic plants are bagged and self-bred or sister crossed to set fruit. Extraction of plant DNA is carried out with the CTAB method proposed by Saghai-Maroof et al.; PCR technology is used to detect exogenous genes;

[0098] Figure 4 The target gene of the transformant is shown in EPSPS The PCR detection results of M: M: DL2000plus; CK1: positive plasmid control; CK2: non-transgenic negative control; blank: double distilled water control; 1-8: EPSPS -1 to EPSPS -6. The PCR detection primers used are (as shown in SEQ ID NO.6, SEQ ID NO.7):

[0099] EPSPS-F :5'ACCGCCCGCAAATCCTCTGGC3'

[0100] EPSPS-R :5'CGGCACCGTGACGCCCTTCAG3'

[0101] Target fragment size: 560bp, annealing temperat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel EPSPS (5-enolpyruvyl-shikimate-3-phosphate synthase) gene, an expression product of the EPSPS gene, a herbicide-resistant gene CTP2-EPSPS (chloroplast transit peptide 2-EPSPS), an expression product and an expression vector of the herbicide-resistant gene CTP2-EPSPS and application of the expression product and the expression vector of the herbicide-resistant gene CTP2-EPSPS. Nucleotide sequences of the EPSPS gene are shown as SEQ ID No.2, amino acid sequences of encoding proteins of the expression product of the EPSPS gene are shown as SEQ ID No.3, the herbicide-resistant gene CTP2-EPSPS contains chloroplast transit peptide CTP2 and the EPSPS gene, nucleotide sequences of the herbicide-resistant gene CTP2-EPSPS are shown as SEQ ID No.5, and the expression product and the expression vector of the herbicide-resistant gene CTP2-EPSPS can be applied to cultivating glyphosate-resistant transgenic corn. The EPSPS gene, the expression product of the EPSPS gene, the herbicide-resistant gene CTP2-EPSPS, the expression product and the application vector of the herbicide-resistant gene CTP2-EPSPS and the application have the advantages that the herbicide-resistant gene can be stably expressed in crop and is high in expression amount, good herbicide-resistant effects can be realized, the corn or other plants can be transited, accordingly, herbicide-resistant characteristics of plants such as the corn can be improved, and an effective way can be provided for improving the herbicide-resistant characteristics of the plants such as the corn during production.

Description

technical field [0001] The invention relates to the field of genetic bioengineering, in particular to a novel 5-enol pyruvyl-shikimate-3-phosphate synthase ( EPSPS ) gene, its expression vector, expression product and its application in cultivating glyphosate-resistant transgenic maize. EPSPS Herbicides active as competitive inhibitors of phosphoenolpyruvate (PEP) exhibit enhanced resistance. Background technique [0002] 5-enolpyruvylshikimate-3-phosphate synthase ( EPSPS ) is a key enzyme in the biosynthesis of aromatic amino acids (including tryptophan, tyrosine, and phenylalanine) in bacteria, fungi, algae, and higher plants. It catalyzes the substrate phosphoenolacetone in the shikimate pathway Acid (phosphoenolpyruate, PEP) and shikimate-3-phosphate (shikimate-3-phosphate, S3P) to synthesize 5-enol pyruvyl shikimate-3-phosphate (EPSP). Glyphosate is a structural analogue of the substrate PEP, which can compete with EPSPS combine to inhibit EPSPS Activity, blocking...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/62C07K19/00C07K14/415C12N15/84C12N1/21A01H5/00
Inventor岳润清铁双贵卢彩霞齐建双韩小花燕树锋刘璐陈娜池海锋傅晓雷
OwnerHENAN ACAD OF AGRI SCI