A kind of sorbitol dehydrogenase gene derived from Pseudomonas syringae and its application

A technology of sorbitol dehydrogenase and Pseudomonas, which is applied in the fields of genetic engineering and enzyme engineering, can solve problems such as unsuitable for industrial application, low activity, and difficulty in distinguishing xylitol, and achieve important industrial application value and transformation high rate effect

Active Publication Date: 2018-10-12
苏州科宁多元醇有限公司
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

from sheep liver, Bacillus subtilis Due to the broad substrate specificity of SDH isolated in , it is difficult to distinguish xylitol (similar in structure to sorbitol) in the sample; Schneider et al. Pseudomonas sp. SDH with low activity to xylitol (only 2% of sorbitol) was isolated, but it was not suitable for industrial application due to low yield; then, Ikuko Masuda et al. Pseudomonas sp. KS-E1806 cloned an SDH gene and constructed genetically engineered bacteria for efficient production of sorbitol dehydrogenase, and applied for patent protection in Europe, the United States, and Japan (Patent No.: EP1262551 (A3), US2003022336 (A1), JP2002355046 (A))

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of sorbitol dehydrogenase gene derived from Pseudomonas syringae and its application
  • A kind of sorbitol dehydrogenase gene derived from Pseudomonas syringae and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Cloning of sorbitol dehydrogenase gene

[0032] Pseudomonas syringae was purchased from the China General Microorganism Culture Collection Center (CGMCC), medium LB (g L -1 ): Yeast extract 5 g, peptone 10 g, NaCl 10 g, add distilled water to 1 L.

[0033] Pseudomonas syringae was inoculated in 5 mL LB liquid medium and cultured at 30°C until logarithmic growth phase, and the genome of Pseudomonas syringae was extracted using DNAKit (TIANGEN, China). The primers used to construct the expression vectors are provided with enzyme cutting sites, and the primer sequences are as follows:

[0034] Upstream primers (SDH-sense containing EcoR I) is:

[0035] 5'-CG GAATTC AAACGACTTGAAGGTAAAAGCG-3'

[0036] Downstream primer (SDH-anti containing xho I) is:

[0037] 5'-CCG CTCGAG TCAGTTCATCCAGTTGCCACCA -3'

[0038] All primers were synthesized by Nanjing GenScript Biotechnology Co., Ltd. PCR conditions of the gene: Denaturation at 94°C for 7 min, followed by 3...

Embodiment 2

[0039] Example 2 Recombinant expression vector pET-28a- sdh build

[0040] use xho Ⅰ and EcoR Ⅰ Respectively digest pET-28a (purchased from Novagen Merck China) and the amplified target gene containing two restriction sites (obtained by PCR amplification in Example 1), and recover the double-digested target fragment and express Vector, the expression vector pET-28a that has been digested with two enzymes and the target gene (the gene shown in SEQ ID NO: 1) were connected overnight with T4-DNA ligase (purchased from TaKaRa Company) to obtain the recombinant vector pET-28a- sdh ; Add 10 μL of the ligation product to 100 μL of Escherichia coli BL21 competent cells, place on ice for 30 min, and heat shock at 42°C for 90 s. Place on ice for 2 min. Add pre-warmed 0.45 mL SOC medium (2% (W / V) peptone, 0.5% (W / V) yeast extract powder, 0.05% (W / V) NaCl, 2.5 mM KCl, 10 mM MgCl 2 , 20 mM glucose. ). 220rpm, 37°C, 1h. Add 200 μL of the bacterial solution to the LB plate contai...

Embodiment 3

[0041] Example 3 Induced expression of sorbitol dehydrogenase gene in Escherichia coli BL21

[0042] pick recombinant bacteria E. coli BL21 (containing pET-28a- sdh ) and control bacteria E. coli BL21 (containing pET-28a) was added to LB liquid medium containing 30 μg / mL kanamycin, and cultured overnight at 37°C with shaking. Then they were inoculated into fresh LB liquid medium containing 30 μg / mL kanamycin according to 2% inoculum amount, and cultivated to OD at 37°C. 600 At about 0.6, add IPTG to a final concentration of 0.2 mmol L -1 , 16°C, 220 rpm, after induction of expression for 24 h, centrifuge (4°C, 5000 rpm, 15 min), resuspend the bacteria sludge with 100 mM Tris-HCl buffer (pH 9.0), and sonicate the cells (power 300 W, ultrasonic 3 s, 5 s intermittent, 5 min in total), centrifuged (4°C, 12000 rpm, 15 min). SDS-PAGE analysis showed that the recombinant bacteria E. coli BL21 (containing pET-28a- sdh ) expresses a protein with a molecular weight of abo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sorbitol dehydrogenase gene from pseudomonas syringae and application of the sorbitol dehydrogenase gene. The gene nucleic acid sequenc is shown as SEQ ID NO:1, a recombinant vector is built, cloning and expression are conducted in escherichia coli, and the sorbitol dehydrogenase amino acid sequence of the gene coding is shown as SEQ ID NO:2. The sorbitol dehydrogenase can effectively catalyze conversion of various important polyhydric alcohols and ketose corresponding to the polyhydric alcohols, the conversion rate to substrate of the sorbitol dehydrogenase is larger than 99%, compared with a traditional production method depending on isomerase, the later-period separation and decoloration costs are greatly lowered, and the sorbitol dehydrogenase gene has important industrial application value.

Description

technical field [0001] The invention belongs to the field of genetic engineering and enzyme engineering, in particular to a sorbitol dehydrogenase gene derived from Pseudomonas syringae and application thereof. Background technique [0002] Sorbitol dehydrogenase (Sorbitol dehydrogenase, referred to as SDH, EC 1.1.1.14) widely exists in microorganisms, plants and animals. It was first discovered in cat liver by Breusch, F. L., etc. (1942). key enzymes. When unutilized glucose enters the polyol pathway, aldose reductase first reduces it to sorbitol and simultaneously oxidizes NADPH to NADP + . In turn, SDH utilizes NAD + The hydrogen acceptor oxidizes the C2 hydroxyl group of sorbitol to produce fructose, which is phosphorylated by hexokinase to form 6-phosphate-fructose and returns to the glycolytic pathway. At present, researchers have investigated dozens of sorbitol dehydrogenases from different sources. It was only by Philippsen, A., Pauly, T.A, etc. who successively...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/53C12N9/04C12N1/21C12N1/19C12N1/15C12P7/18
Inventor严明沙凤魏淼李艳章志林
Owner苏州科宁多元醇有限公司