Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for producing porcine-derived adiponectin

A technology of pig-derived lipids and small molecule ubiquitin, applied in chemical instruments and methods, hormone peptides, specific peptides, etc., can solve problems such as insufficient adiponectin production, achieve easy control of reaction conditions, simple production conditions and steps, and biological Active effect

Active Publication Date: 2019-01-25
中基丰科(山东)生物技术有限公司
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a method for producing pig-derived adiponectin, so as to overcome the current problem of insufficient production of adiponectin in industrial applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for producing porcine-derived adiponectin
  • A method for producing porcine-derived adiponectin
  • A method for producing porcine-derived adiponectin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] 1. The synthesis of the operon that can secrete and express the sumo protease, and the operon that can secrete and express the fusion protein of Saccharomyces cerevisiae small molecule ubiquitin-like protein and porcine adiponectin:

[0032] a) Artificially synthesized fusion DNA fragment SEQ ID No.1 containing the Pglv promoter induced by Bacillus subtilis maltose, the signal peptide sacB encoding the Bacillus subtilis fructansucrase signal peptide, and the expression operon gene encoding the sumo protease (which can be produced by Beijing Synthesized by Aoke Dingsheng Biotechnology Co., Ltd.), its nucleotide sequence is:

[0033] ggatccggcatgtatccgaatcgtacaaaagaaccttttcataagaattggaagggcgtatattcacttaaaattcacagttggtgagactttaagattacaaaaaaggtaaaaaaaccaaatctctcagacataaggcaaatgagaaatttcccgctctatgggaaaaaacactaaagttgatcaaatgacctaagtgcgccaaacgtgttacgggacgagctatctcatggtataaatggaattgtaaaatttatcaaggaggtcggaattcatgaacatcaaaaagtttgcaaaacaagcaacagtattaacctttactaccgcactgctggcaggaggcgcaactc...

Embodiment 2

[0043] Tris-SDS-PAGE identification of pig-derived adiponectin secreted by recombinant Bacillus subtilis BZLS128 strain:

[0044] The supernatant of the fermentation broth of Bacillus subtilis WB700 strain and recombinant Bacillus subtilis BZLS128 strain was freeze-dried, and the protein electrophoresis analysis and concentration ratio were performed using the Tris-SDS-PAGE method.

[0045] 1. Preparation of Tris-SDS-PAGE polyacrylamide gel (separation gel + concentrated gel)

[0046]

[0047] 2. Preparation of related reagents

[0048] a) 30% polyacrylamide: 29g acrylamide and 1g methylene bisacrylamide dissolved in 100mL ddH 2 O;

[0049] b) 1×SDS gel loading buffer: 50mmol / L Tris-HCl (Ph 6.8), 100mmol / L dithiothreitol (added before use), 2% (m / V) SDS (electrophoresis grade), 0.1% bromophenol blue and 10% (V / V) glycerin;

[0050] c) 1×Tris-glycine electrophoresis buffer: 25mmol / L Tris, 250mmol / L glycine (electrophoresis grade) (pH8.3), 0.1% (m / V) SDS; (can be made into 5× storage solu...

Embodiment 3

[0065] Efficient transformation method of Bacillus subtilis WB700 strain:

[0066] 1. Relevant reagent preparation

[0067] Growth medium (GM): peptone 10g / l, yeast powder 5g / l, NaCl 10g / l, sorbitol 0.5M, pH=7.2;

[0068] Electroporation medium (EM): sorbitol 0.5M, mannitol 0.5M, glucose 10%;

[0069] Recovery medium (RM): peptone 10g / l, yeast powder 5g / l, NaCl 10g / l, sorbitol 0.5M, mannitol 0.38M.

[0070] 2. Transformation of Bacillus subtilis WB700 strain

[0071] 1) Inoculate Bacillus subtilis WB700 strain in 3ml LB medium and cultivate overnight;

[0072] 2) Take 2.6ml of overnight culture and insert it into 40ml GM, culture it at 37°C and 200rpm until OD 600=0.85~0.95;

[0073] 3) The bacteria liquid was bathed in ice water for 10 minutes, and then centrifuged at 5000g for 5 minutes at 4°C to collect the bacteria;

[0074] 4) Use 50ml of pre-cooled EM, resuspend the bacteria, centrifuge at 5000g, 5min, 4℃ to remove the supernatant, and rinse 4 times;

[0075] 5) Suspend the washed cell...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for producing pig-source adiponectin. The method includes the steps that operon capable of carrying out secretory expression on sumo protease and operon capable of carrying out secretory expression on saccharomyces cerevisiae small-molecule ubiquitin protein and pig-source adiponectin fusion protein are artificially synthesized, then carriers pZLS-128 through which pig-source adiponectin maternal genes can be expressed in bacillus subtilis are obtained through cloning, and enter competent cells of bacillus-subtilis WB700 strains in an electrotransformation mode, recombined bacillus-subtilis BZLS128 strains are obtained, and pig-source adiponectin protein can be obtained after the recombined bacillus-subtilis BZLS128 strains are subjected to induction fermentation in a flask. The method has the advantages of being simple in expression system, capable of being used for large-scale production, low in production cost and the like; necessary technical supports are provided for commercial application of the pig-source adiponectin.

Description

Technical field [0001] The invention relates to the field of biopharmaceuticals, and specifically provides a method for producing porcine-derived adiponectin. Background technique [0002] Adipose tissue (adiposetissue) is mainly composed of a large number of adipocytes aggregated into clumps, and adiponectin (ADPN) is an endogenous biologically active protein secreted by adipocytes. Adiponectin is an insulin-sensitizing hormone (AnInsulin-sensitizingHormone), which can improve insulin resistance and arteriosclerosis in mice; studies on humans have found that adiponectin levels can predict type II diabetes and coronary heart disease Development and clinical trials have shown anti-diabetic, anti-atherosclerotic and inflammation potential. [0003] Among the biologically active protein factors secreted by adipocytes, adiponectin is one of the most abundant protein products of adipose tissue gene expression, and it is abundant in blood circulation. It appears in circulating plasma i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/575C12N15/75
CPCC07K14/575
Inventor 姬生跃
Owner 中基丰科(山东)生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com