Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A recombinant strain producing trans-4-hydroxy-l-proline and its construction and application

A recombinant strain, proline technology, applied in the direction of recombinant DNA technology, microorganism-based methods, bacteria, etc., can solve the problems of increasing the amount of acid and alkali, increasing the production cycle, environmental problems, etc., to increase the output and reduce the discharge of three wastes. , the effect of convenient separation and purification

Active Publication Date: 2019-01-18
ZHEJIANG LVCHUANG BIOTECHNOLOGY CO LTD
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the construction here also leads to a high concentration of L-proline in the cells. Until the end of fermentation, the concentration of L-proline in the fermentation broth is relatively high, which is about one-third of the concentration of hydroxyproline. In addition, the physical properties of L-proline and hydroxyproline are relatively similar, so it is difficult to separate and purify by simple crystallization methods, and can only be separated and purified by ion exchange resins; and the use of ion exchange resins not only increases the production cycle , and increased the amount of acid and alkali, more seriously, a large amount of acid and alkali wastewater was produced, which brought serious environmental problems and greatly increased the cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A recombinant strain producing trans-4-hydroxy-l-proline and its construction and application
  • A recombinant strain producing trans-4-hydroxy-l-proline and its construction and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: Cloning of L-proline hydroxylase gene and its promoter

[0032] 1. According to the L-proline hydroxylase gene wxya Sequence GenBank: D78338.1 (shown in SEQ ID NO.1) and Bacillus subtilis xylanase promoter Pxyl Sequence (shown in SEQ ID NO.2), synthesized Pxyl + wxya Fragment, add at both ends Eco RI and Kpn I site (shown in SEQ ID NO.3);

[0033] 2. Use Eco RI and Kpn I double digestion Pxyl + wxya , wherein, enzyme digestion system: DNA 43μL, buffer 5μL, Eco RI and Kpn I each 1μL, 37 ℃ incubation for 3 hours. Electrophoresis detection and recovery for future use.

[0034] 3. Cultivate Escherichia coli containing the pUC18 plasmid, and extract the plasmid. The extraction method is operated according to the kit instructions. use Eco RI and Kpn I double-enzyme-digest the plasmid, the enzyme-digestion system is the same as above, detect by electrophoresis and recover for future use.

[0035] 4. Ligation with T4 ligase Pxyl + ...

Embodiment 2

[0037] Example 2: L-glutamate kinase gene proB and L-glutamyl phosphate reductase gene proA gene cloning

[0038] 1. Use the total DNA of Escherichia coli DH5α strain as a template, and use primer F-proB:TAT GGTACC AACTGCCGCTAGGCTTGCTG (shown in SEQ ID NO. 4) and R-proA: GTA GGATCC CGTCAATGGCCTTGTGAATC (shown in SEQ ID NO.5) was amplified proB+proA Gene fragment. Among them, the PCR reaction system includes: template 1 μL Escherichia coli genomic DNA, 1 μL dNTP (10 mmol / L), 2 μmol / L MgCl 2 , 0.5 μmol / L primers, 5 μL 10×PCR buffer, 3 U KODDNA polymerase (purchased from TOYOBO). PCR reaction conditions include: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 40 s, extension at 68°C for 2 min, 25 cycles; 68, 10 min.

[0039] 2, adopt the operation similar to embodiment 1, utilize Kpn I and Bam HI double digestion proB+proA , connected with the same double-digested pUC18-pxyl-proH plasmid, transformed Escherichia coli DH5α,...

Embodiment 3

[0040] Embodiment 3: the cloning of kanamycin resistance gene

[0041] 1. Take the template plasmid pKD4 as the template, and use the primer F-kanR: CAT GGATCC TGTAGGCTGGAGCTGCTTCG (shown in SEQ ID NO.6) and R-kanR: GAC AAGCTT ATGGGAATTAGCCATGGTCC (shown in SEQ ID NO.7) amplifies the kanamycin resistance gene fragment kan R , PCR condition is the same as embodiment 1.

[0042] 2, adopt the operation similar to embodiment 1, utilize Bam HI and Hind III double digestion kan R, connected with the pUC18-pxyl-proH-proB-proA plasmid of the same double digestion, transformed into Escherichia coli DH5α, and obtained a recombinant plasmid, named "pUC18-pxyl-proH-proB-proA-kanR" in the present invention;

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombination strain for producing trans-4-hydroxy-L-proline and building and application of the recombination strain and belongs to the technical field of genetic engineering. The recombination strain for producing the trans-4-hydroxy-L-proline is identified as escherichia coli HJ which is preserved in China Center for Type Culture Collection on September 17th, 2015, and the preservation number of the escherichia coli HJ is CCTCC No. M2015550. The recombination strain has the advantages that wild glutamate kinase controlled by feedback regulation is used to enhance expression, three to-be-expressed genes and expression elements such as related initiators are integrated to the chromosome of the escherichia coli, the to-be-expressed genes can be constantly replicated along with the replication of the chromosome, extremely-high genetic stability is kept, the problem of plasmid loss is solved, effective fermentation cycle is prolonged, and the yield of hydroxyproline is increased.

Description

technical field [0001] The present invention relates to a recombinant bacterial strain producing trans-4-hydroxyl-L-proline and its construction and application, in particular to a recombinant bacterial strain for fermenting and producing trans-4-hydroxyl-L-proline and its construction method and application. Background technique [0002] Trans-4-hydroxy-L-proline, referred to as L-hydroxyproline or hydroxyproline, mainly exists in the collagen of animals, the content can reach about 10%, and its function is to strengthen the elasticity of connective tissue and toughness. In the field of food additives, hydroxyproline is often used as a beverage additive because it has a unique sweetness in a bitter taste, can improve the flavor of juice drinks, and also has skin repairing functions. In the field of cosmetic additives, because hydroxyproline has anti-oxidation and anti-radiation effects, it can eliminate oxidants and adjust the potential effect of redox state of cells, so ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/70C12P13/24C12R1/19
Inventor 储消和吴黎诚程跃生英涛徐顺清陈万河
Owner ZHEJIANG LVCHUANG BIOTECHNOLOGY CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More