A kind of indirect ELISA detection kit and detection method for antibody of Pasteurella multocida of bovine origin
A technology for detection kits and Pasteurella, applied in measuring devices, instruments, scientific instruments, etc., to achieve the effects of high biological safety, high homology, and high homology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1 Screening of bovine-derived Pasteurella multocida specific antigenic protein:
[0026] Sequence the whole genome sequence of Pasteurella multocida type A, B and F strains of bovine origin, through the whole genome of Pasteurella multocida type A, B and F strains of bovine origin Sequence comparison analysis, according to the score value predicted to have a signal peptide, 32 candidate genes were screened from more than 200 genes shared by types A, B, and F, and the amino acid sequences of these genes translated into proteins were transferred to the NCBI database Conduct comparative analysis (http: / / blast.ncbi.nlm.nih.gov) and antigen epitope analysis (http: / / www.cbs.dtu.dk / services / BepiPred / ), and conduct a comprehensive analysis based on the comparison results The total score, coverage, homology and epitope results screened out the 0230 gene; further bioinformatics and PCR analysis of the 0230 gene and its encoded protein proved that the gene and its encoded ...
Embodiment 2
[0027] Example 2 Cloning and expression of Pasteurella multocida 0230 gene and immunoprotective assay of expressed protein:
[0028] According to the CQ2 genome sequence of the bovine Pasteurella multocida capsular serum type A strain, the amplification primers for the 0230 gene were designed: upstream primer 5'-gagtca gaattc gatgtgattgcagataattt; downstream primer 5'-gagtca ctcgag gaacataagaagatgcccat. The underlined segment in the upstream primer is Eco RI restriction site, the underlined segment in the downstream primer is xho I restriction site.
[0029]Genomic DNA of Pasteurella multocida capsular serotype A strain CQ2 from cattle was extracted and used as a template to amplify the 0230 gene by PCR using the primers designed above. The amplification conditions were 94°C for 3min; 94°C for 30s, 60°C ℃ 30s, 72 ℃ 1min, 35 cycles; 72 ℃ extension 10 min, 4 ℃ storage; Eco RI enzyme and xho 1 Enzyme digestion and recovery, the enzyme recovery product is connected wit...
Embodiment 3
[0033] Example 3 Bovine-derived Pasteurella multocida indirect ELISA kit
[0034] The components of the kit include a solid phase carrier coated with purified bovine Pasteurella multocida specific protein 0230, standard positive control serum, standard negative control serum, HRP-labeled rabbit anti-bovine IgG enzyme-labeled secondary antibody, Chromogenic Solution, Stop Solution, Concentrated Wash Solution, Sample Diluent and Serum Dilution Plate. The nucleotide sequence of the bovine Pasteurella multocida specific protein 0230 is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.
[0035] Wherein, the solid phase carrier is a 96-well polystyrene microtiter plate; the bovine-derived Pasteurella multocida specific protein 0230 is a product purified after recombinant expression in Escherichia coli using the method of the above embodiment; Pasteurella mutabilis-specific protein 0230-coated solid phase carrier refers to the use of purified recombinant ant...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com