Mycobacterium tuberculosis antigen protein Rv0865 and application of B cell epitope peptide thereof
A technology of mycobacterium tuberculosis and antigenic protein, which is applied in the fields of molecular biology and immunology, can solve the problems of inapplicable inspection and diagnosis, low sensitivity, and trauma to the body, so as to facilitate quality control, improve detection sensitivity, and reduce false positives. negative effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Cloning of Mycobacterium tuberculosis antigen gene Rv0865 and expression and purification of protein
[0042] 1. Primer design: According to the genome sequence of Mycobacterium tuberculosis H37Rv on NCBI, use the software Primer5 to design primers, upstream primer: CGCGGATCCATGAGCACCCGGTCCGCTCGAA (including BamH1 restriction site), downstream primer: CCAAGCTTTCATCGCGGGTGATCTCCACC (including HindⅢ restriction site).
[0043] 2. Amplification of the target gene: Utilize the CTAB method to extract the genomic DNA of Mycobacterium tuberculosis H37Rv, and use the DNA as a template to amplify the target gene. The PCR reaction system is as follows:
[0044]
[0045] PCR reaction program: hot start at 95°C for 5 min; denaturation at 94°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 1 min, 30 cycles; and finally incubation at 72°C for 10 min.
[0046] 3. Identification of the target gene: Take 7 μl of the PCR product for electrophoresis in 1% agaro...
Embodiment 2
[0094] Example 2 Synthesis of Mycobacterium tuberculosis antigenic protein Rv0865 epitope peptide
[0095] Using the bioinformatics software TE predict and IEDB to predict the B cell epitope on the Rv0865 coding gene, and using the solid-state synthesis method to synthesize the B cell epitope peptide, and then use ELISA to detect the specific antibody in the serum of tuberculosis patients and healthy people. To evaluate the sensitivity and specificity of the antigen for tuberculosis detection.
[0096] The Mycobacterium tuberculosis antigenic protein Rv0865 B cell epitope peptide provided in this example is selected from P207, P208, P209 and P210, and its amino acid sequences are respectively shown in SEQ ID NO: 1-4.
Embodiment 3
[0097] The preparation of embodiment 3 tuberculosis ELISA detection kit
[0098] The basic composition of the test kit is as follows:
[0099] ① The protein antigen Rv0865 or its B cell epitope peptide prepared in Example 1.
[0100] ② Enzyme-labeled reagent: horseradish peroxidase-labeled anti-human or animal mouse IgG monoclonal antibody.
[0101] ③Culture plate: 96-well microwell reaction plate.
[0102] ④ Other reagents and consumables required for ELISA testing.
[0103] The Rv0865 antigen or its epitope peptide was immobilized on the above-mentioned microwell reaction plate.
[0104] The kit is designed based on the principle of indirect enzyme-linked immunosorbent assay. Rv0865 or its epitope peptide is used to detect specific antibodies in serum. The experimental process is: Rv0865 or its B cell epitope peptide is coated on a 96-well microwell plate, After the serum is added, it can bind to the antigen or epitope peptide specific antibody in the serum, and then add...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
