Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mycobacterium tuberculosis antigen protein Rv0865 and application of B cell epitope peptide thereof

A technology of mycobacterium tuberculosis and antigenic protein, which is applied in the fields of molecular biology and immunology, can solve the problems of inapplicable inspection and diagnosis, low sensitivity, and trauma to the body, so as to facilitate quality control, improve detection sensitivity, and reduce false positives. negative effect

Active Publication Date: 2016-12-14
ICDC CHINA CDC
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Diagnosis of tuberculosis generally relies on laboratory diagnosis, imaging examination and clinical diagnosis, etc. In bacteriological diagnosis, sputum smear staining and microscopy are simple and easy, but the concentration of the sample is relatively high, usually with a bacterial content of 5000- Only 10000 / ml can be detected positive, so the positive rate is low, and it is easy to miss the test. Whether the sample is qualified or not directly determines whether the detection rate of sputum bacteria is positive or not.
Sputum culture is the gold standard for tuberculosis diagnosis, but the cycle is long and the success rate of culture is only 80%, which is not conducive to rapid detection
The most commonly used clinically is the skin tuberculin test, but the skin test is interfered by Bacillus Calmette-Guerin (BCG) vaccination and environmental mycobacterial infection, which leads to false positives, making it less sensitive and requiring patients to seek medical attention again
Imaging examinations for tuberculosis, such as routine X-ray examinations, CT examinations, MRI examinations, and ultrasonography, are expensive, traumatic to the body, and have low specificity, so they are not suitable for routine examinations and diagnoses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mycobacterium tuberculosis antigen protein Rv0865 and application of B cell epitope peptide thereof
  • Mycobacterium tuberculosis antigen protein Rv0865 and application of B cell epitope peptide thereof
  • Mycobacterium tuberculosis antigen protein Rv0865 and application of B cell epitope peptide thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Cloning of Mycobacterium tuberculosis antigen gene Rv0865 and expression and purification of protein

[0042] 1. Primer design: According to the genome sequence of Mycobacterium tuberculosis H37Rv on NCBI, use the software Primer5 to design primers, upstream primer: CGCGGATCCATGAGCACCCGGTCCGCTCGAA (including BamH1 restriction site), downstream primer: CCAAGCTTTCATCGCGGGTGATCTCCACC (including HindⅢ restriction site).

[0043] 2. Amplification of the target gene: Utilize the CTAB method to extract the genomic DNA of Mycobacterium tuberculosis H37Rv, and use the DNA as a template to amplify the target gene. The PCR reaction system is as follows:

[0044]

[0045] PCR reaction program: hot start at 95°C for 5 min; denaturation at 94°C for 1 min, annealing at 60°C for 1 min, extension at 72°C for 1 min, 30 cycles; and finally incubation at 72°C for 10 min.

[0046] 3. Identification of the target gene: Take 7 μl of the PCR product for electrophoresis in 1% agaro...

Embodiment 2

[0094] Example 2 Synthesis of Mycobacterium tuberculosis antigenic protein Rv0865 epitope peptide

[0095] Using the bioinformatics software TE predict and IEDB to predict the B cell epitope on the Rv0865 coding gene, and using the solid-state synthesis method to synthesize the B cell epitope peptide, and then use ELISA to detect the specific antibody in the serum of tuberculosis patients and healthy people. To evaluate the sensitivity and specificity of the antigen for tuberculosis detection.

[0096] The Mycobacterium tuberculosis antigenic protein Rv0865 B cell epitope peptide provided in this example is selected from P207, P208, P209 and P210, and its amino acid sequences are respectively shown in SEQ ID NO: 1-4.

Embodiment 3

[0097] The preparation of embodiment 3 tuberculosis ELISA detection kit

[0098] The basic composition of the test kit is as follows:

[0099] ① The protein antigen Rv0865 or its B cell epitope peptide prepared in Example 1.

[0100] ② Enzyme-labeled reagent: horseradish peroxidase-labeled anti-human or animal mouse IgG monoclonal antibody.

[0101] ③Culture plate: 96-well microwell reaction plate.

[0102] ④ Other reagents and consumables required for ELISA testing.

[0103] The Rv0865 antigen or its epitope peptide was immobilized on the above-mentioned microwell reaction plate.

[0104] The kit is designed based on the principle of indirect enzyme-linked immunosorbent assay. Rv0865 or its epitope peptide is used to detect specific antibodies in serum. The experimental process is: Rv0865 or its B cell epitope peptide is coated on a 96-well microwell plate, After the serum is added, it can bind to the antigen or epitope peptide specific antibody in the serum, and then add...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a mycobacterium tuberculosis antigen protein Rv0865 and an application of a B cell epitope peptide thereof in preparing a tuberculosis detection reagent, a vaccine and a drug. The amino acid sequences of the antigen protein Rv0865 and the B cell epitope peptide thereof are respectively shown as SEQ ID NO: 1-5. According to the invention, the mycobacterium tuberculosis antigen protein Rv0865 and the B cell epitope peptide thereof are utilized as stimulants for specific T cell and B cell immune response caused by mycobacterium tuberculosis infection. Compared with the traditional condition adopting complete antigen, the false positive caused by impure antigen can be reduced. The detection reagent prepared by adopting the protein Rv0865 and the epitope peptide thereof can be widely applied to the field of phthisic auxiliary diagnosis and epidemic disease monitoring. The vaccine and the drug prepared by adopting the protein Rv0865 and the epitope peptide thereof can be used for preventing and treating tuberculosis.

Description

technical field [0001] The invention relates to the fields of molecular biology and immunology, in particular to the application of mycobacterium tuberculosis antigenic protein Rv0865 and its B cell epitope peptide in the preparation of tuberculosis detection reagents, tuberculosis vaccines and anti-tuberculosis drugs. Background technique [0002] Tuberculosis is a zoonotic infectious disease caused by Mycobacterium tuberculosis. According to the statistics of the World Health Organization, about 1 / 3 of the world's population is currently infected with Mycobacterium tuberculosis, and about 10% of them may develop active pulmonary tuberculosis. my country's tuberculosis infection rate is 44.5%, which is one of the 22 countries with severe tuberculosis epidemic in the world, and the total number of tuberculosis patients ranks second, second only to India. The 2014 WHO report showed that there were 9 million new cases and 1.5 million deaths from tuberculosis in 2013, of which ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569C07K14/35A61K39/04A61K39/40A61P31/06
CPCA61K39/04A61K2039/505C07K14/35G01N33/5695G01N33/56972G01N2333/35
Inventor 万康林王雪枝李马超刘海灿
Owner ICDC CHINA CDC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com