Recombinant transaminase as well as preparation method and application of recombinant transaminase

A transaminase and amino acid technology, applied in the field of bioengineering, can solve problems such as low product yield and chiral purity, harsh reaction conditions, and long synthetic routes, and achieve excellent stereoselectivity, high reaction conversion rate, and high product yield. The effect of mild reaction

Active Publication Date: 2017-06-06
JIANGSU ALPHA PHARM CO LTD
View PDF8 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The technical problem to be solved by the present invention is to provide a high catalytic activity, high catalytic activity for the disadvantages of sitagliptin and its intermediates, such as the long synthetic route, the need to use toxic raw materials, low product yield and chiral purity, and harsh reaction conditions. A recombinant transaminase with good enantioselectivity and good substrate tolerance, a gene encoding the transaminase, a recombinant expression vector containing the gene, a recombinant expression transformant and a preparation method thereof, and the recombinant transaminase mutant catalyzed in the production of chiral Applications in amine compounds

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant transaminase as well as preparation method and application of recombinant transaminase
  • Recombinant transaminase as well as preparation method and application of recombinant transaminase
  • Recombinant transaminase as well as preparation method and application of recombinant transaminase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] The establishment of embodiment 1 genetically engineered bacteria

[0031] According to the gene sequence of Aspergillus terreus (Aspergillus terreus NIH2624) transaminase recorded in Genbank (NCBI accession number: XM_001209325.1), the gene fragment was artificially synthesized, and the fragment was amplified by PCR (adding NdeI and BamHI endonuclease genes on both sides of the fragment) Fragment), its nucleotide sequence is shown in SEQ ID NO.3. And the gene was inserted into the pET21a plasmid by using the NdeI and BamHI endonuclease sites, and the ligated vector was transferred into Escherichia coli BL21 (DE3) to establish transaminase genetically engineered bacteria. The primers for PCR amplification of the transaminase gene are: forward primer F1: GGGGCCATATGGCCTCCATGGACAAAGTCTTT (SEQ ID NO.4), reverse primer R1: GGGCCGGATCCCGTTATAATCAATCTCGAAGC (SEQ ID NO.5).

Embodiment 2

[0032] The acquisition of embodiment 2 transaminase mutant gene

[0033] In this study, protein engineering of transaminases was carried out using error-prone PCR method. Error-prone PCR is to adjust the reaction conditions when using DNA polymerase to amplify the target gene, such as increasing the concentration of magnesium ions, adding manganese ions, changing the concentration of four kinds of dNTPs in the system, or using low-fidelity DNA polymerase, etc. To change the mutation frequency in the amplification process, so as to randomly introduce mutations into the target gene at a certain frequency, and obtain random mutants of protein molecules. In this study, the principle that a polymerase with low fidelity can easily incorporate random mutations into the amplified product under specific measures was adopted, and at the same time, Mn 2+ Alternative to natural cofactor Mg 2+ increase the probability of error.

[0034] The 50 μl PCR reaction system is: 5 μl of 10× ampl...

Embodiment 3

[0042] The shake flask preparation of embodiment 3 transaminase

[0043] The recombinant Escherichia coli constructed in Example 1 and Example 2 were respectively inoculated into 50 mL of LB medium containing ampicillin (100 μg / mL) (peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH 7.2 ) in a shaker at 37°C and 200 rpm for more than 16 hours. Transfer 2 mL of bacterial culture solution to 50 mL of LB medium containing chloramphenicol (or ampicillin), place it under the same conditions for shaking culture, and regularly measure the absorbance value of the bacterial liquid at 600 nm to monitor the growth density of the bacterial cells. When the OD 600 value of the bacterial solution was 0.6-0.8, the inducer IPTG was added to a final concentration of 0.2 mmol / L, and the expression was induced at 30°C for more than 12 hours. After expression, the cells were collected by centrifugation (5000rpm, 15min, 4°C), washed twice with phosphate buffer (pH7.2, 50mM), dispersed in the sam...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant transaminase as well as a preparation method and application of the recombinant transaminase. An amino acid sequence of a high-activity recombinant transaminase mutant is as shown in SEQ ID NO.2 and a coding gene is as shown in SEQ ID NO.1. The method for preparing the recombinant transaminase compries the steps of fermenting and cultivating a gene engineering bacterium containing the coding gene, and collecting and preparing the recombinant transaminase. The recombinant transaminase is applied to asymmetric synthesis of a chiral amine compound, and particularly is applied to synthesis of a sitagliptin midbody (R)-3-amino-4-(2,4,5-trifluoromethyl phenyl)-methyl butyrate. The related transaminase has excellent stereoselectivity, regioselectivity and catalytic activity, the catalytic reaction is mild, the reaction conversion rate and the yield of a product are high, and the recombinant transaminase has relatively good application prospect.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a recombinant transaminase and its preparation method and application. Background technique [0002] Diabetes is a systemic chronic progressive disease caused by the body's own metabolic disorder, which is caused by insufficient insulin secretion or insulin action disorder. Diabetes is usually accompanied by complications such as coronary heart disease, cerebrovascular disease, nephropathy, and necrosis of lower extremities. It is a complex and frequently-occurring disease. At present, the number of adults with diabetes in the world is 422 million, and it is estimated that by 2025, more than 700 million people worldwide will suffer from diabetes. [0003] Diabetes is mainly divided into type Ⅰ and type Ⅱ. Type Ⅱ diabetes is non-insulin-dependent diabetes, which is caused by insulin resistance or impaired function of pancreatic β cells. Its patients account for...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C12P13/00C07D487/04C12R1/19
CPCC07D487/04C12N9/1096C12P13/001C12Y206/01
Inventor石利平陈峻青蔡进漆志文张维冰叶银梅龚仕荣徐春涛
OwnerJIANGSU ALPHA PHARM CO LTD