Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant expression protein of 1301 ORF136 genes of herpesvirus cyprinid type 3, antibody and application of antibody

A carp herpes virus, gene recombination technology, applied in the direction of antiviral immunoglobulin, virus/bacteriophage, application, etc., can solve the problem that serological diagnosis has not been widely used, and achieve high recovery rate, high purity, good biological active effect

Inactive Publication Date: 2017-08-18
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although there are many detection and diagnosis methods for CyHV-3, they are mainly based on molecular detection technology in practical and wide application, and serological diagnosis has not been widely used.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant expression protein of 1301 ORF136 genes of herpesvirus cyprinid type 3, antibody and application of antibody
  • Recombinant expression protein of 1301 ORF136 genes of herpesvirus cyprinid type 3, antibody and application of antibody
  • Recombinant expression protein of 1301 ORF136 genes of herpesvirus cyprinid type 3, antibody and application of antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Step 1. Amplification of KHV 1301 strain ORF136 gene

[0040] According to the CyHV-3ORF136 gene sequence in GenBank, the bioinformatics software ABCpred (http: / / www.imtech.res.in / raghava / abcpred / ), BepiPred 1.0 (http: / / www.cbs.dtu.dk / services / BepiPred / ) and DNAstar submodule Protean predict the potential B cell epitope of ORF136 gene.

[0041] Design specific primers with Primer Premier 5.0 (specific primers are:

[0042] F: CCG GAATTC GGCACAACAACCATGAACTCTACC (SEQ ID NO: 3) (contains EcoR I restriction site, see the underlined part),

[0043] R: CCG CTCGAG TTAGATTTTTCTAAAGTGCACGACGTC (SEQ ID NO: 4) (containing the Xho I restriction site, see the underlined part),

[0044] And synthesized by Sangon Biotech.

[0045] The virus genome was extracted according to the instructions in the blood / cell / tissue DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., Beijing).

[0046] PCR reaction system: 12.5ul rTaq Mix, 1ul each primer (10umol / L) and 1ul DNA templ...

Embodiment 2

[0063] SDS-PAGE and western blot analysis (Western blot)

[0064] Polyacrylamide gel is composed of 12% separating gel and 4% stacking gel. The purified CyHV-3 1301 strain virus, RIPA lysate lysed KS cells infected with CyHV-3 and KS cells not infected with CyHV-3 Mix with 5× protein loading buffer in proportion, heat in boiling water for 5 minutes, and spot samples for electrophoresis analysis (200V, 35 minutes) after cooling. Transfer the gel separated by SDS-PAGE to a nitrocellulose membrane by wet transfer method, block with 5% skimmed milk powder at room temperature for 1 hour, and then use the polyclonal antibody obtained in step 4 of Example 1 diluted with blocking agent 1:1000 at room temperature Incubate at room temperature for 1 h, then wash with 0.05% PBST for 3 times, each time for 10 min; finally, incubate with HRP-labeled goat anti-rabbit IgG diluted at 1:10000 in blocking agent for 1 h at room temperature, wash with 0.05% PBST for 3 times, and develop DAB color ...

Embodiment 3

[0067] Detection of infected cells by indirect immunofluorescence assay

[0068] The koi snout cells (KS cells) were passaged into 96-well cell culture plates, and after the cells grew to about 80% of the monolayer confluence, they were infected with CyHV-3 1301 strain virus; after 5 days of virus infection, the cells in the culture plates were Aspirate the culture medium, wash with 0.01mol / L PBS three times, add 80% acetone solution and incubate at room temperature for 30min, absorb the acetone, and dry at room temperature for 1h; add 100μl 1:1000 diluted rabbit anti-ORF136 protein polyclonal antibody to each well , incubate at 37°C for 1 hour, wash with PBST three times, add 100 μl of goat anti-rabbit IgG-FITC-labeled fluorescent secondary antibody diluted 1:50, incubate at 37°C for 1 hour; wash with PBST for three times, and finally add the nuclear dye propidium iodide (PI ) for 5 minutes, and observe the results under a fluorescent inverted microscope (Nikon, Eclipse Ti-S)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant expression protein of 1301 ORF136 genes of herpesvirus cyprinid type 3, a polyclonal antibody and an application of the polyclonal antibody. A full-length amino acid sequence of the recombinant expression protein of 1301 ORF136 genes of the herpesvirus cyprinid type 3 is as shown in SEQ ID NO:2, and a full-length nucleotide sequence encoding the protein is as shown in SEQ ID NO:1. A pET32a-ORF136 recombinant prokaryotic expression vector is constructed by selecting one part of gene sequence of ORF136; the recombinant expression protein is obtained through IPTG-induced expression; the obtained polyclonal antibody is subjected to western blot analysis by adopting a purified CyHV-3 virus and a KS cell infected by the CyHV-3; and the detection application of the antibody is further verified by adopting an indirect immunofluorescence assay. An important material is provided for construction of an ORF136 protein function research and CyHV-3 serological diagnosis method through preparation of the polyclonal antibody of the recombinant expression protein of the ORF136 genes.

Description

technical field [0001] The invention belongs to the field of biogenetic engineering, and specifically relates to a recombinantly expressed protein of the ORF136 gene of carp herpesvirus type 3 strain 1301, a polyclonal antibody prepared from the ORF136 recombinantly expressed protein and an application thereof, and further relates to a preparation method of the polyclonal antibody. Background technique [0002] Cyprinid Herpesvirus 3 (CyHV-3), also known as Koiherpesvirus (KHV), is a highly contagious Koiherpesvirus disease (KHVD) that causes carp, Koi and its variants. ) of the pathogen. Since the disease was discovered in Europe in 1997, many countries and regions have reported the explosive death of carp or koi carp caused by the disease, which has brought serious economic losses to the carp and koi breeding industry. CyHV-3 belongs to the order Herpesviridae, the family Heterpesviridae, and the genus Cyprinidae. It is a double-stranded DNA virus with an envelope. The di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/03C07K16/08C07K16/06C12N15/38C12N15/70
CPCC07K14/005C07K16/065C07K16/085C12N15/70C12N2710/16022C12N2800/101
Inventor 王庆郑树城李莹莹曾伟伟王英英刘春任燕石存斌黄琦雯
Owner PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com