Method for improving expression of filamentous fungi lignocellulosic enzyme line and production of bio-based chemicals

A technology of bio-based chemicals and filamentous fungi, applied in the field of genetic engineering, can solve problems such as inability to utilize cellulose

Inactive Publication Date: 2017-10-10
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF7 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CCR can increase the adaptation and competitiveness of microorganisms to the environment, so CCR is beneficial to microorganisms themselves, but unfavorable to industrial applications. The preferential use of carbon sources will inhibit the enzyme genes required for other carbon source metabolic processes The expression of glucose, such as glucose inhibits the expression and secretion of cellulase, resulting in the inability of microorganisms to utilize cellulose

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving expression of filamentous fungi lignocellulosic enzyme line and production of bio-based chemicals
  • Method for improving expression of filamentous fungi lignocellulosic enzyme line and production of bio-based chemicals
  • Method for improving expression of filamentous fungi lignocellulosic enzyme line and production of bio-based chemicals

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0131] Example 1 Acquisition of engineered bacteria

[0132] The transporter protein in the starting strain can be knocked out by conventional techniques.

[0133] Taking the originating strain of Neuromonas crassa (FGSC2489) (purchased from FGSC) as an example, according to the principle of homologous recombination, the entire open reading frame (open reading frame, ORF) of NCU10021 was replaced by the hph gene (hygromycin B resistance gene) ).

[0134] 1) Design homology arm-specific primers

[0135] Upstream homology arm-specific primers:

[0136] NCU10021-5f:GTAACGCCAGGGTTTTTCCCAGTCACGACGCCCACCCCAGACCCAGCACT (SEQ ID NO.: 5);

[0137] NCU10021-5r:ATCCACTTAACGTTACTGAAATCTCCAACACATGGTGTTTGTTGTGACTCTTGTGT (SEQ ID NO.: 6)

[0138] Downstream homology arm-specific primers:

[0139] NCU10021-3f:CTCCTTCAATATCATTCTTCTGTCTCCGACAGCTGCATATTTTGAGCTCCTCGTG (SEQ ID NO.: 7);

[0140] NCU10021-3r:GCGGATAACAATTTCACACAGGAAACAGCCGCACACGTCCGCACTTCCT (SEQ ID NO.: 8)

[0141] Amplif...

Embodiment 2

[0152] Example 2 Verification of engineered bacteria

[0153] Genomic DNA extraction: Genomic DNA was extracted from spores by the phenol-chloroform method

[0154] 1) RCR uses a 25 μL system, including 12.5 μL of 12.5 μL DreamTaq PCR Master Mix, 9.5 μL of water (nuclease-free), 1 μL of upstream and downstream primers, and 1 μL of genomic DNA.

[0155] 2) Perform PCR amplification at 95°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 52°C for 45 seconds, extension at 72°C for 2 minutes, 34 cycles under the same conditions, and finally annealing at 72°C for 10 minutes.

[0156] 3) 110V voltage, 1% agarose gel electrophoresis for 30 minutes, and the gene amplification bands were viewed under the gel imaging system.

[0157]4) Bacteria preservation: After preservation with 30% glycerin, store in a -80°C refrigerator.

Embodiment 3

[0158] Example 3 Growth of Cellulose and Hemicellulose Yield Assays in Single Gene Knockout Mutants

[0159] Utilize the method of embodiment 1, the identification of embodiment 2, construct following bacterial strain and carry out enzyme production kinetics assay to it:

[0160] Partial base mutation or knockout or weakened transporter gene NCU10021 (HGT-1) constructed with Neurospora as the starting strain;

[0161] Partial base mutation or knockout or attenuation of the transporter gene NCU04963 (HGT-2) constructed from Neurospora (Neurospora) as the starting strain.

[0162] The transporter engineered bacteria and wild-type Neurospora crassa were cultured on 2% crystalline cellulose medium for 7 days, and the supernatant of the medium was collected every day, centrifuged and a series of verification tests were carried out.

[0163] method:

[0164] Total enzyme production assay

[0165] Take 20 μL of supernatant, add 1 mL of Bradford protein chromogenic solution...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
affinityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for improving production of a lignocellulosic enzyme line from filamentous fungi and an application of the filamentous fungi in fermentation of microbial bio-based chemicals, and belongs to the field of genetic engineering. According to the method, high-affinity glucose transporter of the filamentous fungi is transformed by virtue of such genetic engineering approaches as knocking-out, mutation, importing and the like, and an obtained engineering strain has the advantages. The filamentous fungi include, but not limited in, neurospora, myceliophthora, trichoderma, aspergillus, penicillin, fusarium and the like; genes of the transporter include NCU10021 (HGT-1) and a homologous gene thereof as well as NCU04963 (HGT-2) and a homologous gene thereof; any one or two genes are knocked out, or bases of any one or two genes are mutated, or expression of any one or two genes is decreased. The engineering strain, which is obtained by importing the transporter into a microbial strain in an exogenous mode or by changing endogenous expression of the transporter, can gain or enhance a glucose transporting and utilizing capacity, and subsequently, a capacity of producing such bio-based chemicals as organic acid, organic alcohol and the like through fermentation can be gained or improved.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and relates to improving the degradation of lignocellulose by fungi or producing cellulase and hemicellulase; improving the transport and absorption of microbial sugar and its application in the fermentation production of bio-based chemicals, involving two sugars The transporter gene NCU10021 (HGT-1) or its homologous gene and NCU04963 (HGT-2) or its homologous gene. Background technique [0002] Plant cellulose is the most widespread and abundant carbohydrate in nature. With the rapid consumption of traditional energy sources, environmental pollution and energy crisis, cellulose has become the focus of research as a renewable energy source with great potential and environmental friendliness. As the most abundant renewable resource on the earth, the utilization efficiency of cellulose is far lower than the requirements of social development. If it can be efficiently converted into usable energ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/80C07K14/37C12N9/42C12N1/15C12N15/31
CPCC07K14/37C12N9/2434C12N9/2437C12N9/2445C12N9/2482C12N15/80C12Y302/01008C12Y302/01021C12Y302/01037C12Y302/01074C12Y302/01091
Inventor田朝光王邦李金根林良才赵军旗刘倩孙涛高婧芳孙文良马延和
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI