Application of grass carp interferon 1 in preparing antibacterial agents
An antibacterial drug, interferon technology, applied in the direction of antibacterial drugs, resistance to vector-borne diseases, pharmaceutical formulations, etc., can solve problems such as loss of aquaculture industry, and achieve the effect of broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Cloning of the open reading frame (ORF) of grass carp interferon 1 gene:
[0023] 1) Cloning of the open reading frame (ORF) of grass carp interferon 1 gene
[0024] The primer IFN-F / R designed to amplify the ORF region of grass carp interferon 1:
[0025] GC_IFN-F1: ATGAAAACTCAAATGTGGACG
[0026] GC_IFN-R2: TTATCGTCTGTTGGCAATGCT
[0027] The PCR reaction system is shown in Table 1;
[0028] Table 1 PCR reaction system
[0029]
[0030] PCR reaction conditions: 95°C pre-denaturation 3min; 95°C pre-denaturation 30s, 58°C annealing 30s, 72°C extension 30s, a total of 35 cycles; 72°C extension 10min; 16°C, 5min. After the reaction, 20μl PCR product was added to 4μl 6╳loadingbuffer and mixed evenly, and electrophoresis detection was carried out with 1.5% agarose gel, 150V, 30min.
[0031] 2) PCR product recovery
[0032] 3) Connect and transform
[0033] This step is performed in accordance with the instructions of the connection kit (TAKARA) company, the connection reaction system is sh...
Embodiment 2
[0049] Cloning of grass carp interferon 1 gene coding region with signal peptide removed and construction of prokaryotic recombinant expression plasmid:
[0050] According to the characteristics of the restriction site on the prokaryotic expression plasmid pGEX-4T-1, a pair of specific primers GC_IFN-F2 / R2 with KpnI and EcoR I restriction sites respectively added:
[0051] GC_IFN-F2: CCG GGTACC GAATGGCTCGGCCGATAC
[0052] GC_IFN-R2: CGC GAATTC TTATCGTCTGTTGGCAAT
[0053] The underlined primer sequences are the restriction sites of Kpn I and EcoR I. Using PCR amplification technology, using the ORF fragment cloned in Example 1 as a template, refer to Example 1 for the reaction procedure. The cloned target band was cut and recovered, and then double-enzyme digested with pGEX-4T-1 vector. The conditions of digestion are shown in Table 3.
[0054] This step is performed in accordance with the instructions of the endonuclease (TAKARA) company, and the digestion system is shown in Table ...
Embodiment 3
[0059] Prokaryotic recombinant expression vector is induced and expressed in E. coli:
[0060] The constructed recombinant expression vector pGEX-4T-1-IFN1 was introduced into E. coli BL21(DE3) plysS competent cells, and the positive clones were picked up on a plate and inoculated in 10ml LB liquid medium containing ampicillin, 37℃, 200rpm overnight Cultivate, add an equal volume of 30% glycerol and store at -35°C for later use.
[0061] (1) Induction of expression: add 1ml spare bacteria to 9ml LB medium and cultivate to OD 600 It is equal to 0.6. At the same time, take 1ml of pGEX-4T-1 empty bacterial solution under the same conditions as a control. Both bacterial solutions are added with IPTG with a final concentration of 1mM, incubated at 37°C, 200rpm. After 4 hours of bacterial solution induction, samples of the experimental group and control group were taken for testing (sample processing method: 4℃, 6000rpm, centrifugation, preserve the bacterial pellet, add 100μl PBS buffer...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More