Litopenaeus vannamei antibacterial peptide gene Lv-BigPEN and recombinant protein and application thereof
A recombinant protein and antibacterial peptide technology, applied in the fields of peptide/protein composition, application, antibacterial drugs, etc., can solve the problems of aquatic food drug residues, ecological damage, diseases, etc., and achieve broad-spectrum antimicrobial activity and great application prospects. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1 Amplification of Lv-BigPEN gene fragment
[0050] 1. Method
[0051] Total RNA of Litopenaeus vannamei was extracted, mRNA was purified and reverse transcribed to obtain cDNA; primers were designed: the forward primer was GGGAATTCGAGGGGCCGCCTGGAGTGCTGCGTCCTC; the reverse primer was GGCTCGAGACAGCAGGAGTTCAGCGCTTGCAG. The PCR reaction solution uses Phanta® Super-Fidelity DNA Polymerase, and the reaction solution components are 2 ul Phanta® Super-Fidelity DNA Polymerase (5U / ul), 50 ul 2×PCR Buffer, 4 ul each of forward and reverse primers (10μM), 2 μl dNTP Mixture, cDNA template 100ng, make up to 100ul with sterile distilled water. The amplification program of the PCR reaction was as follows: pre-denaturation at 94°C for 3 min, 35 cycles: denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, final extension at 72°C for 10 min, and storage at 4°C. After using 1.5% agarose gel electrophoresis, use a gel imaging system to take pict...
Embodiment 2
[0053] Example 2 Litopenaeus vannamei Lv-BigPEN Gene recombinant protein expression
[0054] 1. Construction of expression vector
[0055] Use EcoR I and Xho I endonucleases to double-digest the PMD19T vector containing the target gene, and use T4 ligase (Thermo) to connect the fragment to the prokaryotic expression vector pET32a(+), and transform it into Escherichia coli DH5α competent Cells were cultured overnight, and monoclonal bacteria were selected for PCR detection, and sent to Yingwei Jieji Company for sequencing, and positive clones were screened.
[0056] 2. Transform expression strains
[0057] Use the Omega plasmid extraction kit to extract the recombinant plasmid, transform it into the expression strain Transetta (DE3) by heat shock method, culture overnight, select positive clones, perform PCR detection and send for sequencing, and screen the positive strains; the PCR detection results are as follows: image 3 As shown, Lane 1, 2, 4, 5, 6, and 7 are pET32a-Lv-...
Embodiment 3
[0064] Embodiment 3 antibacterial experiment
[0065] 1. Determination of minimum inhibitory concentration (MIC): Utilize the assay method of minimum inhibitory concentration to measure Gram-negative bacteria: Vibrio parahaemolyticus ( Vibrio parahaemolyticus ), Aeromonas hydrophila ( Aeromonas hydrophila ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa ),Escherichia coli( Escherichia coli ); Gram-positive bacteria: Streptococcus faecalis ( Enterococcus faecalis ), Staphylococcus aureus ( staphylococcus aureus ), Micrococcus xanthus ( Micrococcus luteus ).
[0066] 2. Cultivate overnight in LB medium, dilute the bacterial suspension to 10 with Poor Broth (1% (w / v) peptone, 0.5% sodium chloride, pH=7.5) 5 CFU / ml, take 90 μL of the above bacterial suspension and add it to a sterile 96-well plate. Serial 2-fold dilutions of Lv-BigPEN antimicrobial peptides were made to concentrations of 50 μM, 25 μM, 12.5 μM, 6.25 μM, 3.125 μM, 1.562 μM, 0.781 μM, 0.391 μM, 0.195...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com