Litopenaeus vannamei antibacterial peptide gene Lv-BigPEN and recombinant protein and application thereof

A recombinant protein and antibacterial peptide technology, applied in the fields of peptide/protein composition, application, antibacterial drugs, etc., can solve the problems of aquatic food drug residues, ecological damage, diseases, etc., and achieve broad-spectrum antimicrobial activity and great application prospects. Effect

Active Publication Date: 2018-08-14
SUN YAT SEN UNIV
View PDF9 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The present invention The main purpose of the present invention is to provide a kind of Litopenaeus vannamei antibacterial peptide Lv-BigPEN The preparation and application of genes and their recombinant proteins to solve the current problems of serious aquaculture diseases, ecological damage caused by the abuse of antibiotics, and drug residues in aquatic food

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Litopenaeus vannamei antibacterial peptide gene Lv-BigPEN and recombinant protein and application thereof
  • Litopenaeus vannamei antibacterial peptide gene Lv-BigPEN and recombinant protein and application thereof
  • Litopenaeus vannamei antibacterial peptide gene Lv-BigPEN and recombinant protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1 Amplification of Lv-BigPEN gene fragment

[0050] 1. Method

[0051] Total RNA of Litopenaeus vannamei was extracted, mRNA was purified and reverse transcribed to obtain cDNA; primers were designed: the forward primer was GGGAATTCGAGGGGCCGCCTGGAGTGCTGCGTCCTC; the reverse primer was GGCTCGAGACAGCAGGAGTTCAGCGCTTGCAG. The PCR reaction solution uses Phanta® Super-Fidelity DNA Polymerase, and the reaction solution components are 2 ul Phanta® Super-Fidelity DNA Polymerase (5U / ul), 50 ul 2×PCR Buffer, 4 ul each of forward and reverse primers (10μM), 2 μl dNTP Mixture, cDNA template 100ng, make up to 100ul with sterile distilled water. The amplification program of the PCR reaction was as follows: pre-denaturation at 94°C for 3 min, 35 cycles: denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, final extension at 72°C for 10 min, and storage at 4°C. After using 1.5% agarose gel electrophoresis, use a gel imaging system to take pict...

Embodiment 2

[0053] Example 2 Litopenaeus vannamei Lv-BigPEN Gene recombinant protein expression

[0054] 1. Construction of expression vector

[0055] Use EcoR I and Xho I endonucleases to double-digest the PMD19T vector containing the target gene, and use T4 ligase (Thermo) to connect the fragment to the prokaryotic expression vector pET32a(+), and transform it into Escherichia coli DH5α competent Cells were cultured overnight, and monoclonal bacteria were selected for PCR detection, and sent to Yingwei Jieji Company for sequencing, and positive clones were screened.

[0056] 2. Transform expression strains

[0057] Use the Omega plasmid extraction kit to extract the recombinant plasmid, transform it into the expression strain Transetta (DE3) by heat shock method, culture overnight, select positive clones, perform PCR detection and send for sequencing, and screen the positive strains; the PCR detection results are as follows: image 3 As shown, Lane 1, 2, 4, 5, 6, and 7 are pET32a-Lv-...

Embodiment 3

[0064] Embodiment 3 antibacterial experiment

[0065] 1. Determination of minimum inhibitory concentration (MIC): Utilize the assay method of minimum inhibitory concentration to measure Gram-negative bacteria: Vibrio parahaemolyticus ( Vibrio parahaemolyticus ), Aeromonas hydrophila ( Aeromonas hydrophila ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa ),Escherichia coli( Escherichia coli ); Gram-positive bacteria: Streptococcus faecalis ( Enterococcus faecalis ), Staphylococcus aureus ( staphylococcus aureus ), Micrococcus xanthus ( Micrococcus luteus ).

[0066] 2. Cultivate overnight in LB medium, dilute the bacterial suspension to 10 with Poor Broth (1% (w / v) peptone, 0.5% sodium chloride, pH=7.5) 5 CFU / ml, take 90 μL of the above bacterial suspension and add it to a sterile 96-well plate. Serial 2-fold dilutions of Lv-BigPEN antimicrobial peptides were made to concentrations of 50 μM, 25 μM, 12.5 μM, 6.25 μM, 3.125 μM, 1.562 μM, 0.781 μM, 0.391 μM, 0.195...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a litopenaeus vannamei antibacterial peptide gene Lv-BigPEN and a recombinant protein and application thereof. The Lv-BigPEN is a litopenaeus vannamei Penaeidin (PEN) antibacterial peptide family gene, the length of a nucleotide sequence of the gene is 810 bp, the open reading frame encodes 269 amino acids, and the speculated protein molecular weight is 29.2 kDa. An expression vector Pet32a(+) and an expression strain of escherichia coli Transetta (DE3) are used for performing the prokaryotic recombinant expression, recombinant protein with bioactivity is obtained. Therecombinant protein has the broad-spectrum antimicrobial activity, and is capable of generating the inhibiting effect to multiple bacteria and WSSV viruses. The recombinant protein can be used for producing livestock and aquatic product antibacterial agents, vaccines or feed additives, and has the larger application prospect.

Description

technical field [0001] The invention belongs to the field of biotechnology, and more specifically relates to an antimicrobial peptide gene Lv-BigPEN of Litopenaeus vannamei and its recombinant protein and application. Background technique [0002] Litopenaeus vannamei is the main species of shrimp cultured in my country and has high economic value. In recent years, due to the deterioration of the breeding environment and the excessive breeding density, the frequent occurrence of diseases has seriously threatened the healthy development of the vannamei industry and caused huge economic losses. Therefore, it is particularly important to carry out the prevention and control of shrimp diseases. The diseases of Litopenaeus vannamei are diverse, among which white spot syndrome (WSS), enterosporidiosis (EPH) and acute hepatopancreatic necrosis syndrome (APHNS) are the most serious. In recent years, the abuse of antibiotics in aquaculture has played a certain role in disease contro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/70C12N1/21C07K14/435A61K38/17A61K39/00A61P31/04A61P31/12A23K20/147C12R1/19
CPCA61K38/00A61K39/00A23K20/147A61P31/04A61P31/12C07K14/43504
Inventor李朝政肖邦何建国翁少萍
OwnerSUN YAT SEN UNIV