Carbonyl reductase mutant as well as coding gene and application thereof
A reductase and mutant technology, which is applied to carbonyl reductase mutants and their coding genes and application fields, can solve the problems of difficult post-processing and low catalytic efficiency, and achieve the effect of easy post-processing and high catalytic efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0015] The establishment of embodiment 1 genetically engineered bacteria
[0016] According to the Candida magnoliae ADH3 (GenBank: DQ288128.1) published by Genebank, the gene fragment was artificially synthesized, and the gene fragment was used as a template to amplify the target gene fragment by polymerase chain reaction (PCR) (NdeI was added on both sides of the fragment) and XhoI endonuclease site), the nucleotide sequences of the primers are shown in SEQ ID NO.3 and SEQ ID NO.4. And the gene was inserted into the pET-24a plasmid by using NdeI and XhoI endonuclease sites, and the ligated vector was transferred into Escherichia coli BL21 (DE3) to establish a carbonyl reductase genetically engineered bacterium. The primers for PCR amplification of the target gene are:
[0017] Forward primer: GGGAATTCCATATGACGACTACTTCAAATGCGCTCG (SEQ ID NO.3)
[0018] Reverse primer: CCGCTCGAGCCTCCTGAGCCAGCTTAATGGCGGA (SEQ ID NO.4)
Embodiment 2
[0019] Embodiment 2 Obtaining of carbonyl reductase mutant gene
[0020] In this study, the method of error-prone PCR random mutation was used to transform the carbonyl reductase gene. Error-prone PCR is to use low-fidelity DNA polymerase to amplify the target gene. By adjusting the reaction conditions, such as increasing the concentration of magnesium ions, adding manganese ions, and changing the concentration of four kinds of dNTPs in the system, the amplification process can be changed. Mutation frequency, so as to randomly insert mutations into the target gene to obtain random mutants of different protein molecules.
[0021] The PCR system used in this study is as follows.
[0022] The 50μl PCR system is as follows: 5×PCR Buffer 10μl, dNTP mixture concentration 2.5mmol / L1μl, MgCl 2 (2.5mmol / L) 2μl, MnCl 2 (2.5mmol / L) 2μl, carbonyl reductase template gene 3μl, Taq DNA polymerase 1μl (2.5U / μl), and the rest were added to 50μl of sterilized double distilled water.
[0023...
Embodiment 3
[0031] The shaking flask culture of embodiment 3 recombinant escherichia coli
[0032] The recombinant Escherichia coli obtained in Examples 1 and 2 was inoculated into 100 mL of LB medium containing kanamycin (50 μg / mL) (peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH7.0 ), cultured at 37° C. in a shaker at 250 rpm for 5 hours. Transfer the 1:200 bacterial culture solution to a 200mL shake flask filled with LB medium (containing 50 μg / mL kanamycin), and place it under the same conditions for shaking culture. When the OD600 value of the bacterial solution reaches 0.6-0.8, add the inducer IPTG with a final concentration of 0.4mmol / L, induce the expression of the culture solution at 25°C for 12-16 hours, and collect the bacterial cells by centrifugation (13000rpm, 30min, 4°C). And washed twice with phosphate buffer (pH7.0), then resuspended with 3 times the volume of buffer, ultrasonically disrupted in an ice bath, centrifuged (13000rpm, 10min, 4°C), and then detected by S...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More