Heat-resistant low temperature exo-inulinase mutant MutQ23 delta 3

An exo-inulinase and mutant technology, which is applied in the field of genetic engineering, can solve the problems of poor heat resistance of low-temperature enzymes, and achieve the effect of improving thermal stability

Active Publication Date: 2018-10-30
YUNNAN NORMAL UNIV
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, low-temperature enzymes generally have poor heat resistance, and their heat resistance needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heat-resistant low temperature exo-inulinase mutant MutQ23 delta 3
  • Heat-resistant low temperature exo-inulinase mutant MutQ23 delta 3
  • Heat-resistant low temperature exo-inulinase mutant MutQ23 delta 3

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Construction and Transformation of Embodiment 1 Wild Enzyme InuAGN25DVS Expression Vector

[0036] 1) According to the exo-inulinase nucleotide sequence JQ863108 (SEQ ID No.4) recorded in GenBank, design primers 5'TGGAAGTTCTGTTCCAGGGGCCCCAGACGGGACAGCATAAACAAG 3' and 5'GGTGGTGGTGTTATCTCTTAAATGCAGAAATACCGAT 3', and use the plasmid pEASY-E1-Z2-5 as a template PCR amplification, the exo-inulinase mature peptide coding sequence Z2-5 was obtained, and the HRV 3C protease cleavage site coding sequence was added at the 5' end of Z2-5, and at the 5' end of Z2-5 and the 3 ' end also formed a recombination region that matched the recombination region at both ends of the linearized vector obtained in (2). Z2-5 can also be obtained by gene synthesis.

[0037]2) Also design primers 5'AGAGATAACACCACCACCACCACCACTG 3' and 5'CCTGGAACAGAACTTCCAGGAATTCGGATCCGCGACC 3', and use the pET-28a(+) plasmid as a template for PCR amplification to obtain a linearized pET-28a(+) vector. The 5' and 3...

Embodiment 2

[0042] Example 2 Construction and transformation of mutant enzyme MutQ23Δ3 expression vector

[0043] 1) Synthesize the MutQ23Δ3 coding gene sequence, add HRV 3C protease restriction site coding sequence and EcoRI restriction enzyme cutting site sequence (5'GAATTCCTGGAAGTTCTGTTCCAG 3') at the 5' end of the coding gene during synthesis, and add The XhoI restriction site sequence (5'CTCGAG 3') was added to the 3' end.

[0044] 2) The sequence synthesized in (1) is subjected to EcoRI and XhoI double digestion; at the same time, the expression vector pET-28a(+) is subjected to EcoRI and XhoI double digestion.

[0045] 3) Ligate the digested product in (2) with DNA ligase to obtain the expression vector of the mutant enzyme MutQ23Δ3.

[0046] 4) The ligation product was transformed into Escherichia coli BL21(DE3) to obtain a recombinant strain containing the gene encoding MutQ23Δ3.

Embodiment 3

[0047] Example 3 Preparation of Wild Enzyme InuAGN25DVS and Mutant Enzyme MutQ23Δ3

[0048] Recombinant strains containing Z2-5 and MutQ23Δ3 coding genes were inoculated in LB (containing 50 μg mL -1 Kanamycin) medium, shake rapidly at 37°C for 16h.

[0049] Then inoculate the activated bacterial solution into fresh LB (containing 50 μg mL -1 Kanamycin) medium, rapid shaking culture for about 2–3h (OD 600 After reaching 0.6-1.0), add IPTG with a final concentration of 0.25mM for induction, and continue shaking culture at 20°C for about 20h. Centrifuge at 12000rpm for 5min to collect the bacteria. After suspending the cells with an appropriate amount of McIlvaine buffer with pH=7.0, the cells were ultrasonically disrupted in a low-temperature water bath. The crude enzyme solution concentrated in the cells above was centrifuged at 13,000rpm for 10min, the supernatant was aspirated and the target protein was affinity and purified with Nickel-NTA Agarose and 0-500mM imidazole ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene engineering and protein modification, in particular to a heat-resistant low temperature exo-inulinase mutant MutQ23 delta 3. Amino acid sequence ofthe mutant MutQ23 delta 3 is as shown in SEQ ID NO.1; the optimum pH of the MutQ23 delta 3 is 6.0, and the optimum temperature is 45 DEG C; the mutant MutQ23 delta 3 respectively contains 14%, 24%, 46% and 75% of enzyme activity at the temperature of 0 DEG C, 10 DEG C, 20 DEG C and 30 DEG C; the MutQ23 delta 3 still maintains 100% of enzyme activity after treatment for 60 minutes at the temperature of 50 DEG C; the enzyme can hydrolyze inulin to produce fructose. The heat-resistant low temperature exo-inulinase mutant MutQ23 delta 3 has the advantages of being applicable to industries such asfood, brewing and bioenergy.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to protein transformation technology, in particular to a heat-resistant low-temperature exo-inulinase mutant MutQ23Δ3. Background technique [0002] Inulin is a straight-chain fructan, which is connected by β-fructofuranose molecules through β-2,1 glycosidic bonds, and contains an α-glucopyranose group at its reducing end. Inulin is a plentiful renewable resource found in the roots and stems of plants such as Jerusalem artichoke, chicory, dahlia, burdock and yacon, which are prolific and can contain up to 22% fresh weight or 80% dry weight inulin. Inulinase has two modes of action: one is endo-inulinase, which hydrolyzes the β-2,1 glycosidic bonds inside the inulin polysaccharide chain to generate fructo-oligosaccharides; the other is exo-inulinase, which Hydrolyze β-2,1 glycosidic bonds one by one from the non-reducing end, and finally produce fructose and a small part o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/24C12N15/56C12N15/70
Inventor张蕊黄遵锡周峻沛何丽梅韩楠玉丁俊美许波唐湘华
OwnerYUNNAN NORMAL UNIV