Phospholipase B and application in preparing glycerolphosphocholin thereof

A technology of glycerol phosphatidylcholine and phosphatase, which is applied in hydrolytic enzymes, microbial-based methods, biochemical equipment and methods, etc., can solve the problems of high price, limited sources of animal and plant phospholipase B, and improve catalytic efficiency Effect

Inactive Publication Date: 2018-12-21
NANJING UNIV OF TECH
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, sources of animal and plant phospholipase B are limited and expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phospholipase B and application in preparing glycerolphosphocholin thereof
  • Phospholipase B and application in preparing glycerolphosphocholin thereof
  • Phospholipase B and application in preparing glycerolphosphocholin thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Construction of recombinant Escherichia coli BL21(DE3)-pET28a-plb

[0028] According to the reported Pse μdomonas fl μorescens The amino acid sequence of the source phospholipase B (NCBI accession number: GM367870) was codon-optimized and synthesized. The codon-optimized sequence is shown in SEQ ID NO.1, and restriction sites NcoI and XhoI were designed at both ends.

[0029] Upstream primer P1: (CATGCCATGGGCATGAAAAAAGTTATGCTG)

[0030] Downstream primer P2: (CCGCTCGAGGAAACGGTAGGTAGC), subcloned into vector PET-28a to obtain recombinant plasmid pET-28a-PLB. The constructed recombinant plasmid PET-28a-PLB was transformed into Escherichia coli expression host BL21(DE3) to obtain phospholipase B expression strain BL21(DE3)pET-28a-PLB.

Embodiment 2

[0031] Example 2 Culture and expression of Escherichia coli BL21(DE3)-pET28a-plb

[0032] Pick a single colony of genetically engineered bacteria expressing phospholipase B, inoculate it in LB medium, and culture it overnight at 37°C; then transfer the bacteria to LB medium, the inoculation amount is 1-5% of the volume of LB medium, Cultivate at 37°C for 2-3 hours to OD 0.4-0.6, add IPTG to a final concentration of 0.5mmol / L, culture overnight at 30°C, collect the genetically engineered bacteria expressing phospholipase B by centrifugation, and perform cell disruption at 8000rpm under the condition of centrifugation The supernatant enzyme solution was collected for 20 minutes, and then the enzyme activity was detected.

[0033] Detection method for enzyme activity detection: add 100µL enzyme solution diluted in a certain proportion to 5mL PBS buffer solution (pH 7.0) containing egg yolk lecithin, so that the final concentration of egg yolk lecithin is 60g / L, mix well and place...

Embodiment 3

[0037] Example 3 Research on protein expression of phospholipase B expression strain

[0038]Pick a single colony of genetically engineered bacteria expressing phospholipase B, inoculate it in 5 mL of LB medium, add 50 mg / mL of kanamycin, and culture it at 37°C for 6-8 hours; then transfer the bacteria to LB medium, inoculate The amount is 1-5% of the volume of LB medium, add 50mg / mL kanamycin, incubate at 37°C for 2-3 hours to OD 0.4-0.6, add IPTG to a final concentration of 0.5mmol / L, incubate at 30°C for 12h , collect the genetically engineered bacteria expressing phospholipase B by centrifugation, break the cells, and centrifuge at 8000 rpm for 20 minutes to collect the supernatant enzyme solution, and perform protein electrophoresis on the enzyme solution and the crushed precipitate to verify the protein expression of phospholipase B. At 30°C, under the induction condition of IPTG0.5mmol / L, the study found that there were more serious inclusion bodies (such as image 3 )...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses phospholipase B and application in preparing glycerolphosphocholin thereof. A nucleotide sequence of the phospholipase B is as shown in SEQ ID NO.1. Reconstitution cells whichcomprise the nucleotide sequence as shown in SEQ ID NO.1 are cultured to obtain the phospholipase B. By applying the obtained phospholipase B to glycerolphosphocholin preparation, the problem of a phospholipase B source is solved, meanwhile, the problem of an inclusion body of the phospholipase B is well solved, and the gap of acyl transferring in only using phospholipase A1 for catalysis in the prior art is filled. The method capable of efficiently producing the glycerolphosphocholin is provided for industrial production. By means of the method, the phospholipase B catalytic efficiency, the product yield and the substrate utilization rate can be significantly improved.

Description

technical field [0001] The invention belongs to the field of biocatalysis technology and the preparation of phospholipid products, in particular to a phospholipase B and its application in the preparation of glycerol phosphatidylcholine. Background technique [0002] L-a-glycerol phosphatidylcholine (L-a-GPC, CAS No.: 28319-77-9) is a naturally occurring substance in nature. It is the product of the complete hydrolysis of two fatty acid chains on the phospholipid molecule. It is the product of lecithin metabolism in the body. one of the products. GPC is the precursor for the synthesis of acetylcholine neurotransmitter, and can quickly decompose the intermediates of phospholipid degradation, and can also quickly provide choline across the blood-brain barrier of the brain. It has been proved that it can enhance the release of growth hormone in young individuals and increase Alzheimer's disease. Hormone secretion in patients with dementia, such as the treatment of Alzheimer's ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/18C12N15/70C12N1/21C12P7/64C12P13/00C12R1/19
CPCC12N9/18C12N15/70C12P7/6481C12P13/001C12N2800/22
Inventor陈可泉卢媛媛王昕李辉欧阳平凯
OwnerNANJING UNIV OF TECH