Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of soluble recombinant proteins

A recombinant protein, soluble technology, applied in the field of preparation of soluble recombinant protein, can solve the problems of insoluble and inactive

Inactive Publication Date: 2018-12-21
HENAN RADIOMEDICAL SCI & TECH CO LTD
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, many foreign proteins cannot be folded correctly in E. coli to obtain their natural spatial structure and biological function, but exist in the form of inactive, insoluble inclusion bodies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of soluble recombinant proteins
  • Preparation method of soluble recombinant proteins
  • Preparation method of soluble recombinant proteins

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 11

[0023] Example 1.1 Cloning of human IL-6 gene:

[0024] Method: According to the gene bank published IL-6 gene sequence (serial number: NM00060), use PrimerPremier5.0 software to design a pair of primers P1: 5'ACG GAATTC CCAGTACCCCCCAGGAGAAG 3', the underlined part is the enzyme cutting site EcoRI, P2: 5'AATAG CTCGAG TTACATTTGCCGAAGAGCC 3', the underlined part is the XhoI restriction site. The total mRNA extracted from human peripheral blood lymphocytes was used as a template, and it was first reverse-transcribed into cDNA, and then the cDNA was used as a template to amplify the complete human recombinant IL-6 gene fragment with IL-6 specific primers, and the recovered PCR product was connected to PTG19 -T vector, the plasmid PTG-IL-6 was obtained, which was confirmed to be the correct sequence by sequencing, and the identification results are shown in figure 1 ;

Embodiment 12

[0025] Example 1.2 Prokaryotic expression vector construction:

[0026] 1. Use a DNA recovery kit to recover the PCR product.

[0027] 2. Digest the recovered PCR amplification product with restriction endonuclease with EcoRI and XhoI to obtain the digested product;

[0028] 3. Digest the expression vector pET-32a(+) with restriction endonucleases EcoRI and XhoI, and use the DNA recovery kit to recover the vector skeleton;

[0029] 4. Ligate the digestion product of step 2 and the vector backbone of step 3 with T4 DNA ligase at 4°C overnight to obtain the ligation product;

[0030] 5. Transform the ligation product into Escherichia coli DH5a competent cells, and pick a single colony for colony PCR and enzyme digestion identification: 1) Colony PCR uses primers P1 and P2, and the result is that a colony with a clear single band at about 570bp is a positive colony ; 2) The enzymes used for enzyme digestion identification are restriction endonucleases EcoRI and XhoI, and the co...

Embodiment 13

[0032] Example 1.3 Induced expression of recombinant interleukin 6 and optimization of expression conditions

[0033]1. Inoculate the recombinant engineered bacteria 141 in 5 mL of liquid LB medium containing ampicillin resistance (Amp+), and culture it on a shaker at 37° C. at 200 rpm until the OD600 value is 0.8, then add the inducer IPTG (isopropyl Thiogalactoside, final concentration 0.5mM / L), 180rpm continued to induce culture, and the induction time was 5 hours: a control group was set up at the same time, except that the inducer IPTG was not added, other operations were the same, and the recombinant protein was detected by SDS-PAGE electrophoresis. protein expression, see image 3 ;

[0034] 2 Resuscitate the prepared 141 engineering bacteria and set aside; inoculate the fresh cultures into 5 mL of LB liquid medium containing Amp, shake and culture at 37°C for 3 hours, and adjust the final concentrations of 0.02, 0.04, 0.06, 0.08, Add IPTG at 0.1 and 0.2mM, continue t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of soluble recombinant proteins. According to the preparation method of the invention, a to-be-researched target protein and thioredoxin and His tag are expressed in a fusion manner, by optimizing an expression condition, the solubility expression amount of the target protein can be significantly improved, by utilizing the restriction enzyme cutting site characteristics of enterokinase, the purification of the target protein is rapidly realized by virtue of two-step affinity chromatography, and the purity can reach 95 percent or more. Compared withthe traditional method, by adopting the preparation method of the invention, the expression amount of the soluble recombinant protein can be significantly improved, the instability of the after-treatment renaturation and activity of an inclusion body protein can be avoided, the obtained recombinant protein is high in biological activity and relatively stable, and the application prospect for the mass production of the high-activity recombinant protein is good.

Description

technical field [0001] The invention relates to the technology of applying DNA recombination technology to produce genetic engineering protein medicine, and specifically discloses a preparation method of soluble recombination protein. Background technique [0002] Recombinant protein products such as enzymes, proteins, and antibodies play an indispensable role in people's production, life, and medical treatment. In particular, biotechnology drugs such as recombinant proteins and monoclonal antibodies are the latest generation of drugs that emerged with the development of life sciences in the late 20th century. Compared with traditional small molecule chemical drugs, recombinant protein drugs have significant therapeutic effects and specificity. Strong, low toxicity, small side effects, clear biological functions and other advantages, after more than 30 years of development, it has become one of the most important products in the field of modern biopharmaceuticals. [0003] ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C07K1/36C07K1/34C07K1/22C12N9/00
CPCC07K1/22C07K1/34C07K1/36C12N9/00C12N15/70
Inventor 徐春萍徐红运王磊苗迎春
Owner HENAN RADIOMEDICAL SCI & TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com