Trehalase production strain and application thereof

A technology of trehalase and trehalose, applied in the direction of glycosylase, enzymes, bacteria, etc., can solve the problems of trehalase enzymatic characteristics, such as low energy consumption, high activity and stability, and increase ethanol yield effect

Active Publication Date: 2019-03-08
JIANGNAN UNIV +1
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The application of trehalase in production requires trehalase to have high catalytic activity, good pH stability, and thermal stability. However, there are still relatively few reports on trehalase-producing strains. There are still few studies on the characteristics of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trehalase production strain and application thereof
  • Trehalase production strain and application thereof
  • Trehalase production strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Enrichment and screening process of Erwinia rhapontici

[0036] Collect the soil samples domesticated by trehalose near Wuxi Changguangxi Wetland Park and Jiangnan University. When collecting the soil samples, first use a small shovel to remove the topsoil, use a disinfected plastic bag, and collect the soil from 5-10cm. Take a sample of about 50g, seal it, and record the time, place, and environment. Take 5g of fresh soil sample and dissolve it in 45g of sterile water, take the supernatant and put it into the Erlenmeyer flask containing the enriched medium, shake the flask for 24h. Take 1 mL of the enriched and cultured bacterial solution and transfer it to a pre-prepared test tube containing 9 mL of sterile normal saline, and shake it on a vortex shaker to make 10 -1 The concentration of the sample suspension; then draw 1mL from the above suspension, add it to a test tube containing 9mL of sterile normal saline, shake well to make 10 -2 The concentration of th...

Embodiment 2

[0040] Example 2: Identification of morphological and physiological characteristics of Erwinia rhapontici

[0041] The strains were streaked on a solid LB medium plate, and the colonies that grew out were round, raised, and off-white. The center and surrounding parts of the colonies had no other colors and were easy to pick. Gram staining is red. Observed under an optical microscope, the cells are mostly straight rods with a length of 0.5-1.0μm×1.0-3.0μm. They are solitary or in pairs, sometimes short chains. The strain is gram-negative, oxidase-negative, contact enzyme-positive, and produces acid from fructose, galactose, D-glucose, β-methyl glucoside and sucrose. Malonate, fumarate, gluconate, and malate can be used as the only carbon source and energy source, but benzoate, oxalate, or propionate cannot be used. Identification under microscope and electron microscope ( Figure 1-Figure 3 ).

Embodiment 3

[0042] Example 3: Molecular biological identification of Erwinia rhapontici

[0043] Collect the bacteria grown in the liquid fermentation medium, select the 16S rDNA universal primer 27F (AGAGTTTGATCCTGGCTCAG), 1492R (GGTTACCTTGTTACGACTT) to PCR amplify the bacterial genome, and configure a 50μL PCR reaction system in a 200μL PCR tube according to the formula in Table 2. . After mixing the solution, centrifuge slightly to make the solution completely at the bottom of the PCR tube, and put the PCR tube into the PCR machine.

[0044] Table 2 PCR reaction system

[0045]

[0046] PCR amplification conditions: pre-denaturation at 94°C for 10min, denaturation at 95°C for 60s, annealing at 58°C for 60s, extension at 72°C for 90s, repeated 30 times, and final extension at 72°C for 10min. After the amplification is completed, the PCR amplification result is detected by gel electrophoresis. Stain with 1×TBE buffer, 10×Loading buffer, use 5000DL DNA Maker as the standard Maker, and run at ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a trehalase production strain and application thereof and belongs to the technical field of industrial microorganisms. Erwinia rhapontici C2 provided by the invention is characterized in that the taxonomic name is Erwinia rhapontici and is preserved in China General Microbiological Culture Collection Center (CGMCC) on November 21, 2018, the preservation address is No. 3, No. 1 Yard, West Beichen Road, Chaoyang District, Beijing, and the preservation number is CGMCC No. 16760. The invention reports the Erwinia rhapontici for producing a trehalase for the first time and enzymatic properties of the Erwinia rhapontici are researched. The optimal temperature and pH (Potential of Hydrogen) of the trehalase produced by the strain are 40 DEG C and pH5 respectively; the trehalase has relatively high activity and stability under an acidic condition and has a wide application prospect in an ethanol industry.

Description

Technical field [0001] The invention relates to a trehalase producing bacterium and its application, and belongs to the technical field of industrial microorganisms. Background technique [0002] Trehalose (Trehalose) is a very stable non-reducing disaccharide composed of two glucopyranose rings connected by α,α-1,1-glycosidic bonds. H.A. Wiggers was the first to discover trehalose when studying ergot bacteria in rye in 1832; Mitscherlich then isolated this sugar from mushrooms in 1858 and called it trehalose. Trehalose is ubiquitous in nature and has a wide range of distribution, including bacteria, fungi, insects, lower plants, vertebrates, and particularly high in fungi and insects. It is one of the most recently developed oligosaccharides in the world. One. Although there are many sources of trehalose, there are not many organisms that can accumulate large amounts of trehalose in the body. The decomposition pathway of trehalose has been studied thoroughly in fungi. The res...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12N9/24C12P19/14C12P19/02C12R1/18
CPCC12N1/20C12N9/2402C12P19/02C12P19/14C12Y302/01028C12N1/205C12R2001/18
Inventor董琦龚劲松张新爽许正宏史劲松董哲卿郭鸿飞
OwnerJIANGNAN UNIV