Medical application of small molecule peptide of black food in liver damage repair

A small molecule peptide, black food technology, applied in medical preparations containing active ingredients, microorganism-based methods, peptides, etc., can solve problems such as the pathogenesis of chronic liver injury that has not yet been elucidated, and achieve good anti-inflammatory and repairing effects, The preparation method is simple and practical, and the effect of small toxic and side effects

Inactive Publication Date: 2019-03-26
JILIN UNIV +1
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the prevention and treatment of liver disease is also concerned by the whole world, but the pathogenesis of chronic liver injury has not yet been elucidated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Medical application of small molecule peptide of black food in liver damage repair
  • Medical application of small molecule peptide of black food in liver damage repair
  • Medical application of small molecule peptide of black food in liver damage repair

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0090] 1) Total RNA extraction and reverse transcription

[0091] The total RNA of AtD-SAT yeast was extracted with Total RNA extraction reagent RNAiso Plus, and its integrity was detected by 1% agarose gel electrophoresis, and its concentration and purity were determined by a nucleic acid quantifier. 1 μg of total RNA was taken and analyzed by AOLP For primer: 5'- GGCCACGCGTCGACTAGTACT16 (G / A / C)- 3' reverse transcription to synthesize cDNA;

[0092] 2) Gene cloning, construction of recombinant expression vectors and electrotransformation

[0093] According to the yeast transcriptome sequence information, design specific primers DBTN F: AGCAATGGTG GAAGAGTAAA, and use cDNA as a template to amplify; design primers according to the mature peptide sequence encoded by yeast AtD-SAT gene, and introduce restriction site Eco RI at the 5' end of the primers and Xba I;

[0094] Upstream primer P1: 5'-CGGGAATTCATGTCGTGTGAAGAACTG-3';

[0095] Downstream primer P2: 5'-CTAGTCTGAGGATCCCAT...

Embodiment 2

[0104] 1) Weigh 3kg of black beans, 3kg of black peanuts, 1kg of black sesame, 1kg of black rice, 1kg of black mulberry, 500g of black fungus and 100g of black wolfberry, wash them with flowing water, grind them with broken walls, add 3.4-3.5kg of sugar Quickly pour into the fermenter;

[0105] 2) After sterilizing the material in 1) at 121 degrees Celsius for 20 minutes, add sterile water 3.5-4 times the volume of the material to the fermenter and stir evenly;

[0106] 3) At 25-30 degrees Celsius, add 2.3-2.8 g of the AtD-SAT transgenic yeast strain described in Example 1, and seal it for 3 days for fermentation;

[0107] 4) Raise the temperature of the fermentation broth in step 3) to 50-55°C, add 2.3-2.8g of papain, react at pH 6.0-7.0, and react for 18-24h;

[0108] 5) Put them into centrifuge tubes and centrifuge at 3000-5000r / min for 20-30min, save the supernatant and precipitate separately, and take the supernatant.

Embodiment 3

[0110] 1) Weigh 2kg of black beans, 2kg of black peanuts, 1kg of black sesame, 1kg of black rice, 1kg of black mulberries, 500g of black fungus and 100g of black wolfberry, wash them with flowing water, grind them with broken walls, and add 3.4-3.5kg of sugar Quickly pour into the fermenter;

[0111] 2) After sterilizing the material in 1) at 121 degrees Celsius for 20 minutes, add sterile water 3.5-4 times the volume of the material to the fermenter, and stir evenly after disinfection;

[0112] 3) At 25-28 degrees Celsius, add 2.3-2.8 g of the AtD-SAT transgenic yeast strain described in Example 1, and seal it for 3 days for fermentation;

[0113] 4) Raise the temperature of the fermentation broth in step 3) to 50-55°C, add 2.3-2.8g of papain, react at pH 6.0-7.0, and react for 18-24h;

[0114] 5) Put them into centrifuge tubes and centrifuge at 6000-7000r / min for 20-30min, save the supernatant and precipitate separately, and take the supernatant.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides medical application of small molecule peptide of black food in liver damage repair. Methionine is obtained by fermentation of an AtD-SAT transgenic yeast strain; the small molecule peptide of the black food has good anti-inflammatory and repairing effects on damaged liver cells caused by liver fibrosis and alcoholic hepatitis; drugs prepared from the small molecule peptide of the black food have the advantages of remarkable clinical effect and few toxic and side effects; a preparation method of the small molecule peptide of the black food is simple and practical.

Description

technical field [0001] The invention provides a black food small molecule peptide and a preparation method, and further discloses the medical use of the small molecule peptide in repairing damaged liver damage, which belongs to the technical field of medicine. Background technique [0002] The liver is a key organ in the metabolic process in the body. Long-term exposure to various toxic and harmful substances and exogenous substances may cause chronic liver damage. Liver disease is one of the common diseases that endanger human health, threatening people's life and work. At present, the prevention and treatment of liver disease is also concerned by the whole world, but the pathogenesis of chronic liver injury has not yet been elucidated. Therefore, finding long-lasting, low-toxic and safe liver-protecting drugs is an important direction of current research. [0003] The relative content of oleic acid in peanuts is as high as more than 50%. Oleic acid is beneficial to the h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/19C12N15/81C12N9/10C12P21/00C12P21/06A61K38/01A61P1/16C12R1/84
CPCA61K38/011A61P1/16C07K14/39C12N9/1029C12N15/815C12P21/00C12P21/06C12Y203/0103
Inventor 李婉南梁馨之高波张熙韩露韩笑付学奇胡峻涵沈方舟刘尚常浩
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap