Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of rice aquaporin coding gene osnip1;1

A technology of aquaporin and coding gene, applied in the field of rice aquaporin coding gene OsNIP1, can solve the problem of low gene similarity and achieve the effect of reducing arsenic content

Active Publication Date: 2021-12-10
NANJING AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the aquaporin genes involved in the transport of As(III) in plants in rice are rarely reported except Lsi1, but the similarity between Lsi1 and the OsNIP1; 1 gene of the present invention is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rice aquaporin coding gene osnip1;1
  • Application of rice aquaporin coding gene osnip1;1
  • Application of rice aquaporin coding gene osnip1;1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Transport activity test of aquaporin-encoding gene OsNIP1; 1 in Xenopus laevis oocytes.

[0035] According to the cDNA reading frame sequences of NIP1;1, NIP2;1(Lsi1) and NIP3;1 genes, PCR primers were designed, and restriction endonuclease sites were introduced on the upstream and downstream primers respectively. The primer sequences are shown in the table below.

[0036]

[0037] The amplified PCR product was detected by agarose gel electrophoresis, separated and recovered by cutting the gel. After the product was recovered, it was digested with the corresponding restriction endonuclease, and the frog egg expression vector pT7TS was digested at the same time. The digested vector was combined with The PCR fragments were ligated with T4 ligase, transformed into Escherichia coli and positive clones were extracted for enzyme digestion and DNA sequencing identification. After the correct plasmid was detected and linearized, the mMESSAGE mMACHINE (Ambion) kit w...

Embodiment 2

[0039] Embodiment 2 OsNIP1; Construction of 1 overexpression vector

[0040]1) Extraction of total RNA: Disinfect the rice seeds with 30% sodium hypochlorite solution for 30 minutes, wash 4-5 times with sterile water, then culture them with 1 / 2 MS medium for about 2 weeks, select seedlings with the same size and transfer them to the cultured After culturing in 1 / 2 Kimura nutrient solution for one week, the leaves were stored in liquid nitrogen, and RNA was extracted using a total plant RNA extraction kit (Beijing Biotec Company).

[0041] 2) The total cDNA was synthesized using a reverse transcription kit (Nanjing Nuoweizan Company).

[0042] 3) Obtaining the full length of OsNIP1; 1 gene and constructing the overexpression vector:

[0043] Overexpression primers were designed according to the full-length cDNA sequence of OsNIP1; 1, and the primer sequences were as follows:

[0044] OsNIP1; 1-F:AGAGGATCCCCGGGTACCATGGCAGGAGGTGACAACAACTC (SEQ ID NO. 1);

[0045] OsNIP1; 1-R: ...

Embodiment 3

[0048] Example 3 Aquaporin coding gene OsNIP1; 1 overexpression transgenic material acquisition

[0049] The Agrobacterium transfected with the pTCK303-OsNIP1;1 plasmid obtained in Example 2 was used to infect the Nipponbare rice callus, and after co-cultivation for 2 days, transgenic plants of the T0 generation were obtained through selection, differentiation, rooting, and seedling hardening.

[0050] Reagents and Solutions Abbreviations

[0051] Among the present invention, the used English abbreviation of culture medium is expressed as follows: 6-BA (6-benzyl adenine); Car (carbenicillin); NAA (naphthalene acetic acid); IAA (indole acetic acid); -D (2,4-dichlorophenoxyacetic acid); AS (acetosyringone); CH (hydrolyzed casein); L-pro (L-proline); L-Glu (L-glutamine); MES (2-morpholineethanesulfonic acid); N6 (N6 macroelement solution); B5 (B5 trace element solution); AA (AA macroelement); Agar (agar).

[0052] Solutions and Media Formulations

[0053] Ⅰ hormone preparation...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of rice aquaporin coding gene OsNIP1;1. An aquaporin encoding gene OsNIP1; 1, the accession number in Genbank is AB856419. The gene can be used in reducing the concentration of trivalent As in the mid-pillar part of rice, reducing the loading of trivalent As into the xylem, and significantly reducing the accumulation of arsenic in the shoots and grains of rice. The present invention discovers the biological function of the aquaporin encoding gene OsNIP1;1 in rice through a large number of experiments. After the gene is overexpressed, the As content in the shoot of rice is reduced. Overexpression of this gene significantly reduced As accumulation in rice leaves, seed husks and grains.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to the application of rice aquaporin coding gene OsNIP1;1. Background technique [0002] At present, the problem of heavy metal pollution in the environment is becoming more and more prominent, and the pollution of arsenic (As) in cultivated land is also becoming more and more serious. Rice is an important food crop, and about half of the world's population uses rice as the main food crop. Due to the enrichment of arsenic in rice, rice accounts for 60% of the dietary arsenic intake of the Chinese population (Li et al. 2009). Therefore, it is very important to analyze the mechanism of rice's absorption and detoxification of As and to develop methods to reduce the accumulation of As in rice grains through genetic engineering technology. In soil, arsenic exists in the form of pentavalent arsenic As(V) and trivalent arsenic As(III) under aerobic conditions and flooded conditi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N15/66
CPCC07K14/415C12N15/8271
Inventor 赵方杰孙晟凯唐仲黄新元马建锋
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com