Plant immune activator protein FoPII1 secreted by fusarium oxysporum and its application
A Fusarium oxysporum, immune activation technology, applied in the field of plant immune activation protein, can solve the problems of endangering human health, large usage of chemical fungicides, increased production costs, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1. Isolation and identification of plant immune activation protein FoPII1
[0044] Inoculate Fusarium oxysporum on PDA (get 200 g of peeled potatoes, cut into small pieces, add ultrapure water and boil for 30 minutes, remove the potato pieces by filtering with four layers of gauze, add 20 g of glucose and 15 g of agar powder to the filtrate, and use the filtrate to Make up to 1000Ml with ultra-pure water, subpack after melting, sterilize with high pressure steam at 121°C for 30min) plate, culture at 25°C for 7 days, pick the edge of the colony and inoculate it in 200mL containing PDB (the formula is the same as that of PDA medium, agar powder is not added) ) liquid medium in a 500mL Erlenmeyer flask, cultured on a shaker at 25°C and 180r / min for 5 days to obtain a culture solution of Fusarium oxysporum. The culture filtrate was taken and centrifuged at 4° C. and 8000 rpm for 30 min, and the supernatant was collected and further filtered to remove impurities with...
Embodiment 2
[0045] Example 2. Cloning of the gene encoding the plant immune activation protein FoPII1 and transient expression in plants
[0046] (1) Total RNA extraction:
[0047] The mycelium of Fusarium oxysporum cultured in liquid was used as the material, and the total RNA was extracted using the RNA extraction kit from Omega Company according to the instructions, and the RNA content and quality were detected by a spectrometer.
[0048] (2) reverse transcription to generate the first strand:
[0049] Take 0.7 μg of RNA as a template, carry out cDNA synthesis according to the instructions of Takara’s PrimeScript reverse transcriptase supporting reagent, and dilute to 20 μL for reaction. Take an appropriate amount of reverse transcription product for subsequent gene cloning PCR.
[0050] (3) Using the first strand of cDNA as an RT-PCR template, perform PCR in a conventional method to amplify the full length of the gene encoding FoPII1:
[0051] PCR primer amplified sequence:
[005...
Embodiment 3
[0064] Example 3. Prokaryotic expression and purification of plant immune activation protein FoPII1
[0065] (1) Construction of prokaryotic expression vector
[0066] Design specific primers for the gene encoding the plant immune activation protein FoPII1,
[0067] Upstream primer: SEQ ID NO.5
[0068] (5’-TCCCCAGGA ATTCCC ATGTCGCCCACCACTCCCTCCAAGA -3’)
[0069] Downstream primer: SEQ ID NO.6
[0070] (5'-CGCTCGAGTCGACCC GTTGACAGACAGACTGTAGGC-3'),
[0071] The 50 μL reaction system is: 10 μL of 5× buffer, 4 μL of 2.5 mM dNTPs, 0.5 μL of TakaraPrimerSTARTaq enzyme, 1 μL of template cDNA, and add water to 50 μL; second, 72°C extension for 1 min, 35 cycles, and finally 72°C extension for 10 min; electrophoresis separation on agarose gel, ethidium bromide (EB) staining and photography, record the results, and cut the gel to recover the PCR product of the gene encoding FoPII1. The electrophoresis bands were recovered with Agarose Gel DNA Purification Kit (TaKaRa). The PCR pr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


