Plant immune activator protein FoPII1 secreted by fusarium oxysporum and its application

A Fusarium oxysporum, immune activation technology, applied in the field of plant immune activation protein, can solve the problems of endangering human health, large usage of chemical fungicides, increased production costs, etc.

Active Publication Date: 2019-09-03
NANJING AGRICULTURAL UNIVERSITY
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the large amount of chemical fungicides used and the unscientific application methods, a series of problems such as increased production costs, excessive pesticide residues, crop damage, pathogenic bacteria resistance, and environmental pollution have been broug

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant immune activator protein FoPII1 secreted by fusarium oxysporum and its application
  • Plant immune activator protein FoPII1 secreted by fusarium oxysporum and its application
  • Plant immune activator protein FoPII1 secreted by fusarium oxysporum and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1. Isolation and identification of plant immune activation protein FoPII1

[0044] Inoculate Fusarium oxysporum on PDA (get 200 g of peeled potatoes, cut into small pieces, add ultrapure water and boil for 30 minutes, remove the potato pieces by filtering with four layers of gauze, add 20 g of glucose and 15 g of agar powder to the filtrate, and use the filtrate to Make up to 1000Ml with ultra-pure water, subpack after melting, sterilize with high pressure steam at 121°C for 30min) plate, culture at 25°C for 7 days, pick the edge of the colony and inoculate it in 200mL containing PDB (the formula is the same as that of PDA medium, agar powder is not added) ) liquid medium in a 500mL Erlenmeyer flask, cultured on a shaker at 25°C and 180r / min for 5 days to obtain a culture solution of Fusarium oxysporum. The culture filtrate was taken and centrifuged at 4° C. and 8000 rpm for 30 min, and the supernatant was collected and further filtered to remove impurities with...

Embodiment 2

[0045] Example 2. Cloning of the gene encoding the plant immune activation protein FoPII1 and transient expression in plants

[0046] (1) Total RNA extraction:

[0047] The mycelium of Fusarium oxysporum cultured in liquid was used as the material, and the total RNA was extracted using the RNA extraction kit from Omega Company according to the instructions, and the RNA content and quality were detected by a spectrometer.

[0048] (2) reverse transcription to generate the first strand:

[0049] Take 0.7 μg of RNA as a template, carry out cDNA synthesis according to the instructions of Takara’s PrimeScript reverse transcriptase supporting reagent, and dilute to 20 μL for reaction. Take an appropriate amount of reverse transcription product for subsequent gene cloning PCR.

[0050] (3) Using the first strand of cDNA as an RT-PCR template, perform PCR in a conventional method to amplify the full length of the gene encoding FoPII1:

[0051] PCR primer amplified sequence:

[005...

Embodiment 3

[0064] Example 3. Prokaryotic expression and purification of plant immune activation protein FoPII1

[0065] (1) Construction of prokaryotic expression vector

[0066] Design specific primers for the gene encoding the plant immune activation protein FoPII1,

[0067] Upstream primer: SEQ ID NO.5

[0068] (5’-TCCCCAGGA ATTCCC ATGTCGCCCACCACTCCCTCCAAGA -3’)

[0069] Downstream primer: SEQ ID NO.6

[0070] (5'-CGCTCGAGTCGACCC GTTGACAGACAGACTGTAGGC-3'),

[0071] The 50 μL reaction system is: 10 μL of 5× buffer, 4 μL of 2.5 mM dNTPs, 0.5 μL of TakaraPrimerSTARTaq enzyme, 1 μL of template cDNA, and add water to 50 μL; second, 72°C extension for 1 min, 35 cycles, and finally 72°C extension for 10 min; electrophoresis separation on agarose gel, ethidium bromide (EB) staining and photography, record the results, and cut the gel to recover the PCR product of the gene encoding FoPII1. The electrophoresis bands were recovered with Agarose Gel DNA Purification Kit (TaKaRa). The PCR pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a plant immune activator protein FoPII1 secreted by fusarium oxysporum and its application. The protein is capable of inducing plant resistance and can be applied as a plant immune activator to the field of plant disease control. An amino acid sequence of the protein is shown in SEQ ID NO: 2. The high-concentration protein can be obtained by using engineering strain expression, which can be used to improve the disease resistance of tobacco and soybean, and the involved plant diseases are tobacco mosaic disease and soybean root rot. The plant immune activator protein notonly can significantly improve plant disease resistance, but also has the advantages of low required concentration, quick effect and long acting time. The FoPII1 provides a novel way to improve plantdisease resistance and control plant diseases.

Description

technical field [0001] The invention relates to the technical field of design biology, in particular to a plant immune activation protein secreted by Fusarium oxysporum and its application. Background technique [0002] Fusarium oxysporum (Fusarium oxysporum) is a worldwide distribution of soil-borne pathogenic fungi with a wide range of hosts, which can cause more than 100 types of plant wilts such as legumes, solanaceae, melons, bananas, cotton, and flowers. , causing huge losses to agricultural production (Gordon and Martyn, 1997). Due to the lack of disease-resistant varieties against Fusarium oxysporum in production, the prevention and control of diseases caused by this pathogen is difficult, and chemical control is mainly relied on. Due to the large amount of chemical fungicides used, coupled with unscientific application methods, a series of problems such as increased production costs, excessive pesticide residues, crop damage, pathogenic bacteria resistance, and env...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K14/37C12N15/31C12N15/70C12N1/21A01H5/00A01H6/54A01H6/82C12R1/19
CPCC07K14/37C12N15/8282C12N15/8283C12N15/70C12N2800/22
Inventor 王源超杨波王雨音柳泽汉郑文跃
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap