Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A biosensor and detection method technology, applied in the field of molecular biology, to achieve the effect of detection at the single-cell level
Inactive Publication Date: 2019-09-06
CHINA AGRI UNIV +1
View PDF8 Cites 8 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
At present, HCR-based Salmonella detection technology is relatively rare
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0062] 1. Experimental materials
[0063] 1.1 Test strains
[0064] Salmonella (CGMCC 1.0090), Enterobacter sakazakii (CICC 21560), Listeria monocytogenes (CMCC55004), Staphylococcus aureus (ATCC 25923), Vibrio parahaemolyticus (CMCC20001), Escherichia coli (ATCC43889) were all imported from China Provided by the Food Safety Laboratory of the School of Food Science and Nutritional Engineering, Agricultural University.
[0092]In the present invention, the RPA reaction is first carried out, and the reaction conditions are 39° C. and 20 minutes. The RPA reaction was carried out with different ratios of primers, and the optimal ratio of primers was found for constant temperature amplification. After the reaction was completed, the amplified products were analyzed by 2% agarose gel electrophoresis. It can be obtained that all the products amplified by RPA with the newly designed primers are longer than the DNA fragments amplified without the universal sequence (comparison sequence RPA-R: CCTCAATACTGAG CGGCTGCTCGCCTTTGCTGG, see Table 1); and when the upstream primer: downstream Primer: Universal Primer=3:1:2, the brightness of the electrophoresis band is brighter than other bands (swimming lane 8), indicating that the amount of RPA product is also the largest ( figure 1 ).
[0093] 2. Optimization of Lambda exonuclease reaction conditions
[0...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention relates to the technical field of molecular biology, and in particular, relates to a biosensor and method for detecting salmonella. The biosensor includes an RPA reaction reagent, a Lambda nucleic acid exonuclease cutting reaction reagent, an HCR reaction reagent and a chromogenic reagent. A double-stranded nucleic acid of salmonella is amplified by a multi-enzyme system, and dsDNA phosphorylated at the 5' end is obtained. 5'-phosphorylated strands in the dsDNA are digested by Lambda exonuclease, and RPA products become single strands. A universal junction is exposed, an HCR reaction is initiated, and released G-tetrad binds to Hemin to form G4 DNAzyme, colorless TMB is catalyzed to be oxidized into blue oxTMB visible to naked eyes by H2O2, and then salmonella is detected through the change of color and absorbance value. The biosensor has the advantages of visualization, versatility, rapidity and high sensitivity.
Description
technical field [0001] The invention relates to the technical field of molecular biology, in particular to a biosensor and method for detecting Salmonella. Background technique [0002] Salmonellosis refers to the general term for different forms of diseases caused by various types of Salmonella to humans, domestic animals and wild animals. People infected with Salmonella or the feces of carriers can contaminate food and cause food poisoning. According to statistics, among the types of bacterial food poisoning in various countries in the world, food poisoning caused by Salmonella often ranks first. [0003] At present, the detection technology of Salmonella mainly relies on enzyme-linked immunosorbent technology, DNA molecular nucleic acid probe or gene probe technology, biochemical identification technology, and biosensor technology. Compared with traditional detection methods, the main advantage of biosensor technology is that it has high sensitivity and can detect targe...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more