Biosensor and method for detecting salmonella

A biosensor and detection method technology, applied in the field of molecular biology, to achieve the effect of detection at the single-cell level

Inactive Publication Date: 2019-09-06
CHINA AGRI UNIV +1
View PDF8 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, HCR-based Salmonella detection technology is relatively rare

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biosensor and method for detecting salmonella
  • Biosensor and method for detecting salmonella
  • Biosensor and method for detecting salmonella

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] 1. Experimental materials

[0063] 1.1 Test strains

[0064] Salmonella (CGMCC 1.0090), Enterobacter sakazakii (CICC 21560), Listeria monocytogenes (CMCC55004), Staphylococcus aureus (ATCC 25923), Vibrio parahaemolyticus (CMCC20001), Escherichia coli (ATCC43889) were all imported from China Provided by the Food Safety Laboratory of the School of Food Science and Nutritional Engineering, Agricultural University.

[0065] 1.2 Main reagents

[0066] Yeast extract powder, peptone, yeast extract, beef extract, glucose, dipotassium hydrogen phosphate, ammonium citrate, anhydrous sodium acetate, magnesium sulfate heptahydrate, manganese sulfate tetrahydrate, Tween 80, sodium chloride, agar, ethyl alcohol Diaminetetraacetic acid (EDTA), sodium hydroxide, tris(Tris), glacial acetic acid, hemin (Hemin), agarose, 3,3',5,5'-tetramethylbis Aniline (TMB), RPA reaction kit, sulfuric acid, terminal deoxynucleotidyl transferase (TdT), double-strand specific nuclease (DSN), dGTP, dATP...

Embodiment 2

[0091] 1. Optimization of RPA reaction conditions

[0092]In the present invention, the RPA reaction is first carried out, and the reaction conditions are 39° C. and 20 minutes. The RPA reaction was carried out with different ratios of primers, and the optimal ratio of primers was found for constant temperature amplification. After the reaction was completed, the amplified products were analyzed by 2% agarose gel electrophoresis. It can be obtained that all the products amplified by RPA with the newly designed primers are longer than the DNA fragments amplified without the universal sequence (comparison sequence RPA-R: CCTCAATACTGAG CGGCTGCTCGCCTTTGCTGG, see Table 1); and when the upstream primer: downstream Primer: Universal Primer=3:1:2, the brightness of the electrophoresis band is brighter than other bands (swimming lane 8), indicating that the amount of RPA product is also the largest ( figure 1 ).

[0093] 2. Optimization of Lambda exonuclease reaction conditions

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of molecular biology, and in particular, relates to a biosensor and method for detecting salmonella. The biosensor includes an RPA reaction reagent, a Lambda nucleic acid exonuclease cutting reaction reagent, an HCR reaction reagent and a chromogenic reagent. A double-stranded nucleic acid of salmonella is amplified by a multi-enzyme system, and dsDNA phosphorylated at the 5' end is obtained. 5'-phosphorylated strands in the dsDNA are digested by Lambda exonuclease, and RPA products become single strands. A universal junction is exposed, an HCR reaction is initiated, and released G-tetrad binds to Hemin to form G4 DNAzyme, colorless TMB is catalyzed to be oxidized into blue oxTMB visible to naked eyes by H2O2, and then salmonella is detected through the change of color and absorbance value. The biosensor has the advantages of visualization, versatility, rapidity and high sensitivity.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a biosensor and method for detecting Salmonella. Background technique [0002] Salmonellosis refers to the general term for different forms of diseases caused by various types of Salmonella to humans, domestic animals and wild animals. People infected with Salmonella or the feces of carriers can contaminate food and cause food poisoning. According to statistics, among the types of bacterial food poisoning in various countries in the world, food poisoning caused by Salmonella often ranks first. [0003] At present, the detection technology of Salmonella mainly relies on enzyme-linked immunosorbent technology, DNA molecular nucleic acid probe or gene probe technology, biochemical identification technology, and biosensor technology. Compared with traditional detection methods, the main advantage of biosensor technology is that it has high sensitivity and can detect targe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/689C12Q1/6844C12R1/42
CPCC12Q1/689C12Q1/6844C12Q2521/507C12Q2521/319C12Q2525/301C12Q2525/191C12Q2521/345
Inventor许文涛田洪涛罗云波张媛李舒婷田晶晶朱龙佼杜再慧
OwnerCHINA AGRI UNIV