Method for preparing small-molecule hyaluronic acid by enzymatic digestion method, obtained small-molecule hyaluronic acid and application thereof
A technology of hyaluronic acid and hyaluronidase, applied in the biological field, can solve the problems of unsuitable enzymatic large-scale production of small molecule hyaluronic acid, animal virus safety risks, structural damage, etc., and achieves good product uniformity and easy control. , the effect of complete structure
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1. Cloning of hyaluronan lyase gene and construction of recombinant vector
[0050]Using the total DNA of Arthrobacter globiformis HL6 with the preservation number CCTCC M 2018452 as a template, through the functional gene analysis of the database, amplify with primers EC-F and EC-R containing restriction endonuclease sites Hyaluronan lyase gene HyLs (without signal peptide):
[0051] EC-F: GGACTAGTCATGTTCGCCAACCACGCCT (SEQ. ID. No. 3)
[0052] EC-R: GGGGTACCCGGATACCGGGCGACGTTAGC (SEQ.ID.No.4)
[0053] Among them, ACTAGT is the restriction site of endonuclease Spe Ⅰ, and GGTACC is the restriction site of endonuclease Kpn Ⅰ.
[0054] PCR is used for amplification, and the 50 μl reaction system is:
[0055] In a 50 μL reaction system containing DNA template, 1 μL; EC-F (10 μM), 1 μL; EC-R (10 μM), 1 μL; dNTP (2.5 mM each), 4 μL; Taq (2U / μL), 1 μL; 10× Taq buffer, 5 μL; ddH2O, added to 50 μL.
[0056] The PCR amplification program was: pre-denaturation at 95°C...
Embodiment 2
[0060] Example 2. Preparation of Hyaluronidase by Fermentation of Arthrobacter globiformis HL6
[0061] The preservation number is CCTCC NO: M 2018452 Arthrobacter globiformis HL6 is inoculated into the sterilized seed culture medium (seed culture medium formula is: sodium hyaluronate 0.2g / L, glucose 5g / L, peptone 2g / L L, dipotassium hydrogen phosphate 1.5g / L, MgSO 4 0.5g / L, pH 7.5), 32°C, 200r / min, cultivated for 24h to obtain seed liquid. Inoculate the seed culture liquid into the sterilized fermentation medium according to 1% inoculum size (sodium hyaluronate 2g / L, glucose 10g / L, peptone 5g / L, dipotassium hydrogen phosphate 1.5g / L, MgSO 4 0.5g / L, pH 7.5), 28°C, 200r / min culture for 24h, the fermentation broth was centrifuged at 4°C, 8000r / min for 10min, the fermentation supernatant was collected, and the hyaluronidase activity was determined to be 1×10 5 U / mL.
Embodiment 3
[0062] Example 3. Recombinant expression of hyaluronidase in Escherichia coli
[0063] 1. Select Escherichia coli strain DH5α, prepare competent cells, heat shock transformation (42°C, 60s), and incubate (37°C, 160rpm, 45min), and screen transformants on LB solid plates containing 75 μg / mL ampicillin sodium. Transformed strains cannot grow on plates. After PCR detection, positive cloned strains were obtained, and the plasmid was extracted with the Plasmid Mini Kit (OMEGA Bio-Tek Co.) kit to obtain the recombinant plasmid HTa-HyLs.
[0064] Select the Escherichia coli expression strain BL21(DE3), and transform the extracted recombinant plasmid HTa-HyLs into the Escherichia coli expression strain BL21 after preparing competent cells, heat shock transformation (42°C, 60s), and incubation (37°C, 45min). (DE3), screened on 75 μg / mL ampicillin LB solid plate, cultured at 37°C for 16 hours to obtain transformants, selected single colony transformants for PCR detection, and obtained ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com