Method for preparing small-molecule hyaluronic acid by enzymatic digestion method, obtained small-molecule hyaluronic acid and application thereof

A technology of hyaluronic acid and hyaluronidase, applied in the biological field, can solve the problems of unsuitable enzymatic large-scale production of small molecule hyaluronic acid, animal virus safety risks, structural damage, etc., and achieves good product uniformity and easy control. , the effect of complete structure

Active Publication Date: 2019-10-15
MARINE BIOMEDICAL RES INST OF QINGDAO CO LTD
View PDF5 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Since the currently marketed hyaluronidases are mainly hyaluronidase enzymes derived from animal tissues, they have problems such as low activity, high cost, and safety risks of animal viruses, and are not suitable for large-scale production of small-molecule hyaluronic acid by enzymatic methods. The main method of industrial production of small molecule hyaluronic acid is still chemical degradation, but there are problems such as structural damage and environmental pollution. It is urgent to develop a new, safe and low-cost hyaluronidase to realize industrial production of small molecule hyaluronic acid by enzymatic method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing small-molecule hyaluronic acid by enzymatic digestion method, obtained small-molecule hyaluronic acid and application thereof
  • Method for preparing small-molecule hyaluronic acid by enzymatic digestion method, obtained small-molecule hyaluronic acid and application thereof
  • Method for preparing small-molecule hyaluronic acid by enzymatic digestion method, obtained small-molecule hyaluronic acid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1. Cloning of hyaluronan lyase gene and construction of recombinant vector

[0050]Using the total DNA of Arthrobacter globiformis HL6 with the preservation number CCTCC M 2018452 as a template, through the functional gene analysis of the database, amplify with primers EC-F and EC-R containing restriction endonuclease sites Hyaluronan lyase gene HyLs (without signal peptide):

[0051] EC-F: GGACTAGTCATGTTCGCCAACCACGCCT (SEQ. ID. No. 3)

[0052] EC-R: GGGGTACCCGGATACCGGGCGACGTTAGC (SEQ.ID.No.4)

[0053] Among them, ACTAGT is the restriction site of endonuclease Spe Ⅰ, and GGTACC is the restriction site of endonuclease Kpn Ⅰ.

[0054] PCR is used for amplification, and the 50 μl reaction system is:

[0055] In a 50 μL reaction system containing DNA template, 1 μL; EC-F (10 μM), 1 μL; EC-R (10 μM), 1 μL; dNTP (2.5 mM each), 4 μL; Taq (2U / μL), 1 μL; 10× Taq buffer, 5 μL; ddH2O, added to 50 μL.

[0056] The PCR amplification program was: pre-denaturation at 95°C...

Embodiment 2

[0060] Example 2. Preparation of Hyaluronidase by Fermentation of Arthrobacter globiformis HL6

[0061] The preservation number is CCTCC NO: M 2018452 Arthrobacter globiformis HL6 is inoculated into the sterilized seed culture medium (seed culture medium formula is: sodium hyaluronate 0.2g / L, glucose 5g / L, peptone 2g / L L, dipotassium hydrogen phosphate 1.5g / L, MgSO 4 0.5g / L, pH 7.5), 32°C, 200r / min, cultivated for 24h to obtain seed liquid. Inoculate the seed culture liquid into the sterilized fermentation medium according to 1% inoculum size (sodium hyaluronate 2g / L, glucose 10g / L, peptone 5g / L, dipotassium hydrogen phosphate 1.5g / L, MgSO 4 0.5g / L, pH 7.5), 28°C, 200r / min culture for 24h, the fermentation broth was centrifuged at 4°C, 8000r / min for 10min, the fermentation supernatant was collected, and the hyaluronidase activity was determined to be 1×10 5 U / mL.

Embodiment 3

[0062] Example 3. Recombinant expression of hyaluronidase in Escherichia coli

[0063] 1. Select Escherichia coli strain DH5α, prepare competent cells, heat shock transformation (42°C, 60s), and incubate (37°C, 160rpm, 45min), and screen transformants on LB solid plates containing 75 μg / mL ampicillin sodium. Transformed strains cannot grow on plates. After PCR detection, positive cloned strains were obtained, and the plasmid was extracted with the Plasmid Mini Kit (OMEGA Bio-Tek Co.) kit to obtain the recombinant plasmid HTa-HyLs.

[0064] Select the Escherichia coli expression strain BL21(DE3), and transform the extracted recombinant plasmid HTa-HyLs into the Escherichia coli expression strain BL21 after preparing competent cells, heat shock transformation (42°C, 60s), and incubation (37°C, 45min). (DE3), screened on 75 μg / mL ampicillin LB solid plate, cultured at 37°C for 16 hours to obtain transformants, selected single colony transformants for PCR detection, and obtained ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for preparing small-molecule hyaluronic acid by an enzymatic digestion method, the obtained small-molecule hyaluronic acid and application thereof. According to the method for preparing the small-molecule hyaluronic acid by the enzymatic digestion method, the obtained small-molecule hyaluronic acid and the application thereof, hyaluronic acid with a molecular weightgreater than 600 kDa or salts of the hyaluronic acid are degraded by using hyaluronidase prepared by fermentation of arthrobacter globiformils HL6 with the preservation number being CCTCC NO:M 2018452 or hyaluronidase as shown in SEQ ID NO:1, the small-molecule hyaluronic acid or salts of the small-molecule hyaluronic acid are prepared, the process of the method is easy to operate, the conditionis mild, no environmental pollution and animal source virus pollution exist, no damage is caused to a product structure, the product homogeneity is good, and environmentally friendly industrial production of the small-molecule hyaluronic acid is realized. The prepared small-molecule hyaluronic acid has the advantages of high purity, safety and non-toxicity, good moisturizing, transdermal absorption, anti-oxidation and anti-inflammatory activities, is widely used in the fields of food, cosmetics and medicine, can further be used as a standard product for the research on the structure and quality of hyaluronic acid, and has broad research and application prospects.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for preparing small-molecule hyaluronic acid by enzymatic cleavage, the obtained small-molecule hyaluronic acid and its application. Background technique [0002] Hyaluronic acid (HA) is a macromolecular mucopolysaccharide composed of N-acetylglucosamine and D-glucuronic acid disaccharide units repeatedly linked alternately. An important component of synovial fluid and cartilage tissue, it has unique physical and chemical properties and biological functions. Due to its high viscoelasticity and plasticity, super strong water holding capacity and permeability, and good biocompatibility, it is widely used in the fields of food, cosmetics and medicine. [0003] Recent studies have found that the biological activity of HA is directly related to its relative molecular weight, and HA with different molecular weights has different or even opposite biological activities....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/26A23L33/10A61K31/728A61K8/73A61P39/06A61Q19/08A61Q19/00C12R1/06
CPCA23V2002/00A61K8/735A61K31/728A61Q19/00A61Q19/08A23L33/10A61P39/06C12P19/26A23V2200/318A23V2200/30
Inventor江晓路张京良王鹏
OwnerMARINE BIOMEDICAL RES INST OF QINGDAO CO LTD