Unlock instant, AI-driven research and patent intelligence for your innovation.

Klebsiella oxytoca for expressing luciferase and application of klebsiella oxytoca

A Klebsiella oxytoca, luciferase gene technology, applied in the directions of enzymes, enzymes, applications, etc., can solve the problems of cumbersome production process, in-depth research on infection prevention and control, unstable competence efficiency, etc., and achieves easy operation. Easy to obtain, prevent nosocomial infection, and improve the effect of connection efficiency

Inactive Publication Date: 2020-04-03
BEIJING DITAN HOSPITAL CAPITAL MEDICAL UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Studies in recent years have shown that Klebsiella oxytoca is one of the common infectious bacteria after surgery, but the research on the prevention and control of this bacterial infection has not been in-depth
Traditionally, chemical methods are used to make Klebsiella competent cells, the production process is cumbersome and the competent cell efficiency is unstable

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Klebsiella oxytoca for expressing luciferase and application of klebsiella oxytoca
  • Klebsiella oxytoca for expressing luciferase and application of klebsiella oxytoca
  • Klebsiella oxytoca for expressing luciferase and application of klebsiella oxytoca

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1 Contains the construction of the pan-host plasmid of luciferase gene

[0054] 1. LUXA / B / C / D / E gene cluster amplification:

[0055] (1), design the primer pair of LUX gene cluster

[0056] LUX F: GATTCAATTGTGAGCGGATAAC (SEQ ID NO. 1);

[0057] LUX R: ATTTGTCCTACTCAGGAGAG (SEQ ID NO. 2).

[0058] The lowercase bold sequence in the primer is the complementary sequence between this sequence and pBBR1.

[0059] The length of the pBAV1k-T5-LUX plasmid is 10546bp, and its lux A / B / C / D / E gene cluster is controlled by the T5 promoter, with a total of 5663bp. We use Q5 high-fidelity DNA polymerase and a primer pair containing the LUX gene cluster. During the design process, the same sequence as pBBR1 was added ( figure 1 Shown in A), amplify the LUX A / B / C / D / E group of pBAV1k-T5-LUX plasmid.

[0060] (2), LUX A / B / C / D / E gene cluster PCR amplification

[0061] Table 1: LUX A / B / C / D / E Gene Cluster Amplification PCR Reaction System

[0062]

[0063] After conf...

Embodiment 2

[0086] Example 2 Detection of Klebsiella oxytocin luciferin gene expression containing luciferase

[0087] 1. Preparation of Klebsiella oxytoca competent for electroporation

[0088] A single colony of Klebsiella oxytoca was picked and inoculated in liquid BHI medium, and cultured overnight at 37°C. Take the Klebsiella oxytoca cultured overnight and inoculate it into fresh BHI medium at a ratio of 1:10, and culture it statically at 37°C until OD 600 = 0.3 to 0.4. Take out the bacterial liquid in the logarithmic phase, after 30min in ice bath, centrifuge at 4°C and 4000rcf to collect the bacterial cells, wash the bacterial cells with pre-cooled sterile double distilled water and pre-cooled 1% sucrose solution respectively, and then the acid-producing grams Lebsiella competent cells.

[0089] 2. Electrotransformation of pBBR1-LUX A / B / C / D / E plasmids:

[0090] Take 5 μl of pBBR1-LUX A / B / C / D / E plasmid and add it to 100 μl of Klebsiella oxytoca competent cells, mix well and ice-ba...

Embodiment 3

[0094] Example 3: Detection of luciferase intensity at different concentrations of KOX-D1 / pBBR1-LUX A / B / C / D / E

[0095] Pick KOX-D1 / pBBR1-LUX A / B / C / D / E single colony strains and culture them at 37°C for 4 hours, then use the NanoDropTM One ultra-micro-volume ultraviolet spectrophotometer to detect the bacterial OD value. Based on 1OD=10 9 Bacterial concentration was calculated from colony-forming unit (Cfu). The obtained strain was diluted 6 gradients according to 1:10, and the Luminesence value was detected on a microplate reader, and the results were as follows: Figure 5 As shown, the Luminesence value decreases with the decrease of the colony concentration, when the strain concentration is 10 6 Cfu and 10 5 At Cfu, the fluorescence intensities are 5869±215.9 and 660.2±215.9 respectively, lower than 10 5 When Cfu, its fluorescence cannot be detected in the small animal imager, therefore, when recommending that this bacterium is used for animal experiments, the enrichment...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
electrical resistanceaaaaaaaaaa
fluorescenceaaaaaaaaaa
Login to View More

Abstract

The invention constructs Klebsiella oxytoca containing luciferase gene cluster (luciferase gene cassette, lux) by utilizing plasmid construction and an electric transformation technology. Through autofluorescence identification, a subculture stability test of strains and observation of culture characteristics, the Klebsiella oxytoca (KOX-LUX) capable of stably expressing luciferase is finally obtained. An important visual research tool is provided for researching the progress of Klebsiella oxytoca related diseases and screening proper sterilization methods, antibiotics and the like.

Description

technical field [0001] The invention relates to the field of microbial medicine, in particular to a method for constructing a pan-hosted plasmid containing a luciferase gene and a Klebsiella oxytoca stably expressing luciferase, the strain obtained by the method, and the strain obtained during screening and sterilization Methods or applications in drug screening and preparation of animal models of infection. Background technique [0002] Klebsiella oxytoca (KOX) is a Gram-negative bacterium common in community and hospital infections, and the capsular polysaccharide on its surface is the main virulence factor. Klebsiella oxytoca can express extended spectrum β-lactamases (ESBL) and carbapenemase, so it can produce β-lactam and carbapenem antibiotic resistance, which has become a clinical Therefore, there is an urgent need for powerful tools to assess the efficacy of current antibiotic use, appropriate drugs, such as antibiotics or other bactericidal methods. [0003] Biolu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/74C12N1/21C12N15/53C12Q1/22C12Q1/02A01K67/027A61L2/18A61L2/10C12R1/22A61L101/06
CPCA01K67/0271A01K2207/12A01K2227/105A01K2267/03A01K2267/0337A61L2/10A61L2/18A61L2202/24C12N9/0069C12N15/74C12Q1/02C12Q1/22
Inventor 滑明溪陈晨曾辉李昂
Owner BEIJING DITAN HOSPITAL CAPITAL MEDICAL UNIV