Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of β-agarase and its application in agar quantitative detection

A technique for quantitative detection of agarase, which is applied in the field of biotechnology and biochemical detection, can solve the problems of poor accuracy, time-consuming and laborious, cumbersome operation, etc., and achieve the effect of high accuracy, good linear range and fast enzymatic hydrolysis rate

Active Publication Date: 2022-06-17
OCEAN UNIV OF CHINA
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved in the present invention is that the commonly used agar quantitative detection methods are phenol-sulfuric acid method and high performance liquid chromatography, and these two methods have the problems of poor accuracy and complicated operation, time-consuming and labor-intensive respectively

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of β-agarase and its application in agar quantitative detection
  • A kind of β-agarase and its application in agar quantitative detection
  • A kind of β-agarase and its application in agar quantitative detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Cloning, expression and acquisition of β-agarase Aga16_Wa in Escherichia coli

[0043] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until late logarithmic phase and the whole genome DNA was extracted. The upstream and downstream primers (5'-GACTGGTTCCAATTGACAAGC; 5'-GACACCTCGAGCTATTGATATACTCTTACATAATCTATTTC) were designed according to the target gene, and PCR was performed using the whole genome as a template. The PCR reaction conditions were as follows: : 95°C for 3min, 95°C for 20s, 42°C for 22s, 72°C for 60s, 22 cycles, and last at 72°C for 5min to obtain the β-agarose Aga16_Wa gene fragment, which was connected to the pET-28a(+) vector to form a recombination plasmid. The recombinant plasmid was introduced into BL21(DE3) competent cells to form a recombinant strain. The positive clones were screened and induced to express by isopropyl thiogalactoside in LB medium containing ampicillin, the induction temperature was 17℃, and the induction ...

Embodiment 2

[0044] Example 2: Cloning, Expression and Acquisition of β-Agarase Aga16_Wa in Bacillus subtilis

[0045] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of logarithmic phase and the whole genome DNA was extracted. The upstream and downstream primers (5'-GGATGACTGGTTCCAATTGACAAGC; 5'- TAAGACACCTCGAGCTATTGATATACTCTTACATAATCTATTTC) were designed according to the target gene, and the whole genome was used as a template for PCR to obtain β-agar Carbohydrase Aga16_Wa gene fragment, ligated to pHT01 vector, constitutes a recombinant plasmid. The recombinant plasmid was transformed into Bacillus subtilis competent cells, and positive clones were screened and induced to express in LB medium with isopropyl thiogalactoside. The induction temperature was 37°C and the induction time was 12h. The cells were collected by centrifugation, and a certain amount of 20mM Na was added. 2 HPO 4 -NaH 2 PO 4 The buffer was suspended, and then sonicated in an ice-water b...

Embodiment 3

[0047] Example 3: Cloning, expression and acquisition of β-agarase Aga16_Wa in Pichia pastoris

[0048] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of logarithmic phase and the whole genome DNA was extracted. The upstream and downstream primers (5'-AGGTGACTGGTTCCAATTGACAAGC; 5'- CCGGACACCTCGAGCTATTGATATACTCTTACATAATCTATTTC) were designed according to the target gene, and the whole genome was used as a template for PCR to obtain β-agar Carbohydrase Aga16_Wa gene fragment, connected to pPIC9k vector to form a recombinant plasmid, added to Pichia pastoris GS115 competent cells to form recombinant cells; screened positive clones and inoculated into YPD medium, cultured at 30°C for 20h, and then inoculated into BMGY culture The cells were cultured on a shaker at 30°C and 200rpm until OD600=2.0, the cells were collected by centrifugation, the supernatant was discarded, the pellet was resuspended in BMMY medium, and the culture was induced with methanol ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of biotechnology and biochemical detection, in particular to a β-agarase and its application in agar quantitative detection. The enzyme has a novel amino acid sequence and good enzymatic properties, and its amino acid sequence is SEQ ID NO.1. The present invention develops a kit for detecting agar content by using β-agarase Aga16_WA: including reagent A, reagent B, reagent C and calibrator, wherein reagent A contains β-agarase Aga16_WA and a stabilizer. The kit has good linear range and high accuracy, and can be popularized and used in the market.

Description

technical field [0001] The invention relates to the technical field of biotechnology and biochemical detection, in particular to a beta-agarase and its application in quantitative detection of agar. Background technique [0002] Agar is a kind of hydrophilic colloid extracted from red algae, mainly composed of β-d-galactose and 3,6-lactone-l-galactose through β-1,4 glycosidic bonds and α-1,3 Formed by cross-linking of glycosidic bonds, it is one of the most widely used seaweed gums in the world. Because of its good gelation and food safety, it is widely used in food industry, pharmaceutical industry, daily chemical industry, bioengineering and many other aspects. In the food industry, as an important food additive, agar can be used in jelly, dairy products, ice cream, canned food and meat products. agent. As a kind of dietary fiber, proper intake of agar will be of great benefit to the human body, but too much or too little intake is not conducive to human health. Too muc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/38C12N15/56C12Q1/40
CPCC12N9/2468C12Y302/01081C12Q1/40G01N2333/938
Inventor 常耀光陈广宁薛长湖申晶晶张玉莹石菲菲薛勇张恬恬
Owner OCEAN UNIV OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com