A kind of β-agarase and its application in agar quantitative detection
A technique for quantitative detection of agarase, which is applied in the field of biotechnology and biochemical detection, can solve the problems of poor accuracy, time-consuming and laborious, cumbersome operation, etc., and achieve the effect of high accuracy, good linear range and fast enzymatic hydrolysis rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1: Cloning, expression and acquisition of β-agarase Aga16_Wa in Escherichia coli
[0043] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until late logarithmic phase and the whole genome DNA was extracted. The upstream and downstream primers (5'-GACTGGTTCCAATTGACAAGC; 5'-GACACCTCGAGCTATTGATATACTCTTACATAATCTATTTC) were designed according to the target gene, and PCR was performed using the whole genome as a template. The PCR reaction conditions were as follows: : 95°C for 3min, 95°C for 20s, 42°C for 22s, 72°C for 60s, 22 cycles, and last at 72°C for 5min to obtain the β-agarose Aga16_Wa gene fragment, which was connected to the pET-28a(+) vector to form a recombination plasmid. The recombinant plasmid was introduced into BL21(DE3) competent cells to form a recombinant strain. The positive clones were screened and induced to express by isopropyl thiogalactoside in LB medium containing ampicillin, the induction temperature was 17℃, and the induction ...
Embodiment 2
[0044] Example 2: Cloning, Expression and Acquisition of β-Agarase Aga16_Wa in Bacillus subtilis
[0045] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of logarithmic phase and the whole genome DNA was extracted. The upstream and downstream primers (5'-GGATGACTGGTTCCAATTGACAAGC; 5'- TAAGACACCTCGAGCTATTGATATACTCTTACATAATCTATTTC) were designed according to the target gene, and the whole genome was used as a template for PCR to obtain β-agar Carbohydrase Aga16_Wa gene fragment, ligated to pHT01 vector, constitutes a recombinant plasmid. The recombinant plasmid was transformed into Bacillus subtilis competent cells, and positive clones were screened and induced to express in LB medium with isopropyl thiogalactoside. The induction temperature was 37°C and the induction time was 12h. The cells were collected by centrifugation, and a certain amount of 20mM Na was added. 2 HPO 4 -NaH 2 PO 4 The buffer was suspended, and then sonicated in an ice-water b...
Embodiment 3
[0047] Example 3: Cloning, expression and acquisition of β-agarase Aga16_Wa in Pichia pastoris
[0048] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of logarithmic phase and the whole genome DNA was extracted. The upstream and downstream primers (5'-AGGTGACTGGTTCCAATTGACAAGC; 5'- CCGGACACCTCGAGCTATTGATATACTCTTACATAATCTATTTC) were designed according to the target gene, and the whole genome was used as a template for PCR to obtain β-agar Carbohydrase Aga16_Wa gene fragment, connected to pPIC9k vector to form a recombinant plasmid, added to Pichia pastoris GS115 competent cells to form recombinant cells; screened positive clones and inoculated into YPD medium, cultured at 30°C for 20h, and then inoculated into BMGY culture The cells were cultured on a shaker at 30°C and 200rpm until OD600=2.0, the cells were collected by centrifugation, the supernatant was discarded, the pellet was resuspended in BMMY medium, and the culture was induced with methanol ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
| concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


