Esterase, coding gene, vector, recombinant cells and application thereof
A technology of recombinant cells and esterase, applied in the field of genetic engineering and enzyme engineering, can solve problems such as unsatisfactory and achieve great application potential
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Example 1: Acquisition and sequence analysis of the gene sequence encoding esterase E2-1404 derived from Antarctic soil
[0058] The source of the strain: Escherichia coli EPI300 clone E2-1404 in the metagenomic library of soil samples at site E2 near the Great Wall Station in Antarctica.
[0059] Specific steps are as follows:
[0060] 1.1 Construction of subcloning library
[0061] Use the BAC / PAC DNA extraction kit from OMEGA Company to extract the large fragment plasmid fosmid in E. coli EPI300 clone E2-1404 according to its instructions. Then the fosmid extracted was partially digested with restriction endonuclease Sau3AI (purchased from Fermentas Company) to obtain a DNA fragment of 2,000-5,000bp, which was connected to the pUC19 plasmid (purchased from BamHI) digested and dephosphorylated by BamHI. from NEB Corporation). Electroporate E.coli Top10 competent cells with the ligation reaction solution, coat LB solid plate containing 100 μg / ml ampicillin and 1% (v...
Embodiment 2
[0066] Example 2: Cloning, heterologous expression and separation and purification of esterase
[0067] 2.1 Using PCR to amplify the gene sequence
[0068] (1) Design two specific primers according to the gene E2-1404 sequence:
[0069] 1404F:AAGAAGGAGATATACATATGCGCATGTACCCGATTTCTCCGCA
[0070] (SEQ ID NO.3);
[0071] 1404R: TCGAGTGCGGCCGCAAGCTTGACCTGTGTCAGCCGCTCGCTCC
[0072] (SEQ ID NO.4);
[0073] Primers were synthesized by Jinan Boshang Biotechnology Co., Ltd.
[0074] (2) Using 1404F and 1404R as primers and using the fosmid where the gene E2-1404 is located as a template, use FastPfu DNA polymerase (purchased from Transgen) to amplify the target gene fragment;
[0075] The PCR reaction conditions were: pre-denaturation at 95°C for 2 min; then denaturation at 95°C for 20 sec, annealing at 50°C for 20 sec, extension at 72°C for 1 min, and after 30 cycles; extension at 72°C for 10 min.
[0076] (3) 1 wt% agarose gel electrophoresis was performed on the PCR amplificat...
Embodiment 3
[0099] Embodiment 3: the property determination of Antarctic esterase E2-1404
[0100] 3.1 Substrate specificity analysis
[0101] pNP ester substrates with different carbon chain lengths, C2, C4, C8, C10, C12, and C14 (purchased from Sigma), were prepared with isopropanol.
[0102] The standard response is:
[0103] 20 μl of 10 mM pNPC4 substrate and 960 μl of 50 mM Tris-HCl (pH 8.0) mixture was preheated at 40°C for 3 minutes, then 20 μl of the diluted enzyme solution was added and reacted at 40°C for 10 minutes, and 100 μl of 20 wt% SDS (sodium dodecyl sulfate) was added immediately ) to terminate the reaction and measure the OD405 value. The reaction without enzyme solution was used as blank control. The standard curve was drawn with different concentrations of pNP (purchased from Sigma).
[0104] Enzyme activity is defined as the amount of enzyme required to catalyze the hydrolysis of pNP ester substrate to produce 1 μM pNP per minute at a certain temperature, which is ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More