Novel coronavirus pseudovirus, and preparation method and application thereof

A coronavirus and pseudovirus technology, applied in the field of new coronavirus pseudovirus and preparation, can solve the problems of inability to simulate amplification, false negative, easy degradation, etc., and achieve the effect of simple and effective method, low detection limit, and improved efficiency

Inactive Publication Date: 2020-08-25
武汉海关技术中心
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These positive reference substances all have different defects, such as inactivated virus requires a biosafety level 3 laboratory, and the safety of inactivated virus cannot be guaranteed; the nature of reverse-transcribed RNA is very unstable, difficult to store, and easy to degrade; plasmid As a universal positive template, it cannot simulate the whole steps from RNA extraction to nucleic acid amplification, and the quality control is insufficient.
These reasons will lead to inaccurate detection reactions and even false negative results.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Preparation of a novel coronavirus pseudovirus:

[0039] Select the partial sequence (12750-13491) of ORF1ab in the SARS-CoV-2 genome, the partial sequence (28850-29300) of the N gene and the full sequence of the E gene (26245-26472) NheI and BamHI restriction enzyme sites were added to the 'end for gene synthesis, named Cov2-F (shown in SEQ ID NO.1). The CoV2-F gene was constructed into the intermediate cloning vector pUC-SP, named pUC-CoV2-F.

[0040] A three-plasmid system was selected for the assembly of the pseudovirus, which were the packaging plasmid psPAX2, the envelope plasmid PMD2.G, and the vector backbone plasmid pCDH-CMV-MCS-EF1-copGFP. Respectively use restriction endonucleases Nhe I and BamH I to perform double enzyme digestion on pUC-CoV2-F and pCDH-CMV-MCS-EF1-copGFP, then recover and purify the digested fragment CoV2-F, and ligate to prepare the vector backbone Plasmid pCDH-CMV-CoV2-F-EF1-copGFP.

[0041]A large number of extracted and purified pseu...

Embodiment 2

[0044] Triple fluorescent PCR detection of a novel coronavirus pseudovirus:

[0045] With reference to the specific sites of SARS-Cov-2 virus ORF1ab, N and E gene sequence, the primers and probes of fluorescent RT-PCR are designed, and the following sequences are all located in the design sequence of pseudovirus CoV2-F:

[0046] N gene:

[0047] NF:ATTCAACTCCAGGCAGCAGT

[0048] NR:GCTCTCAAGCTGGTTCAATCTGT

[0049] NP:Cy5-CTGGCAATGGCGGTGATGCTGCTCTTGCTT-BHQ3

[0050] ORF1ab gene:

[0051] OF:GATGACAATGCGTTAGCTT

[0052] OR:AGCCCATTTCAAATCCTG

[0053] OP: TAMRA-TTGTACTTGCACTGTTATCCGATT-BHQ2

[0054] E gene:

[0055] EF: AGTTACACTAGCCATCCT

[0056] ER: CTCACGTTAACAATATTGCAG

[0057] EP: FAM-ACTGCGCTTCGATTGTGTGCGT-BHQ1

[0058] Pseudovirus was gradient to 10 times by 10 times 6 Two-fold dilution was used as a standard, and the nucleic acid was extracted using the QIAamp Viral RNAMiniKit Viral RNA Extraction Kit. The triple target gene method was used for one-step fluoresc...

Embodiment 3

[0064] RT-RPA Constant Isothermal Amplification of Novel Coronavirus Pseudovirus:

[0065] will be 10 6 The copy / μL pseudovirus was gradient to 1 copy / μL with a 10-fold gradient. The nucleic acid was extracted using the QIAamp Viral RNAMini Kit viral RNA extraction kit. Primers and probes were designed for the ORF1ab gene of the pseudovirus prepared in Example 1. The reaction system: 25 μL Reaction system: Tris-HCl (pH 7.9) 50mM, potassium acetate 100mM, magnesium acetate 14mM, dNTPs 200μM, creatine kinase 100ng / μL, phosphocreatine 50mM, dithiothreitol 2mM, ATP 3mM, PEG 35K 5%, primers HL39-F and HL39-R 300nM each, probe HL39-P 100nM, Uvs X 120ng / μL, Uvs Y 60ng / μL, polymerase Bsu 30ng / μL, gp32 single-chain binding protein 600ng / μL, exonuclease III 5U, reverse Recording enzyme 10U, RNA template 2μL, mix well by inverting up and down, and centrifuge at low speed for 10 seconds.

[0066] The reaction program is as follows: 39°C, 40s, 1 cycle; 39°C, 30s, 40 cycles, select the FA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and particularly discloses a novel coronavirus pseudovirus, and a preparation method and application thereof. The prepared pseudovirus has no replication nor infection activity, and the biological safety is reliable. The suspension can reach about 10<6> copies / microliter, the indexes of uniformity and stability have no significant difference, and the requirements of positive reference substances can be met. Pseudovirus particles are used as a positive reference substance, and a triple fluorescent RT-PCR method is developed. The linear fitting coefficients between the nucleic acid content and the amplification Ct values of three target genes are all 0.99 or above, and the positive reference substance is calibrated at 1.2*10<4> copies / microliter. An RT-RPA constant-temperature isothermal amplification method is developed, and the detection limit can reach 10 copies / microliter.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically discloses a novel coronavirus pseudovirus, a preparation method and an application thereof. Background technique [0002] Symptoms of coronavirus infection can range from the common cold to severe lung infections. SARS-CoV-2 is a new type of coronavirus of the genus β, with a diameter of about 60-140 nm, an envelope, and particles that are round or oval, often pleomorphic. SARS-CoV-2 can be found in human respiratory epithelial cells after in vitro isolation and culture for about 96 hours, while it takes about 6 days for isolation and culture in African green monkey kidney cell line Vero and human liver cell line Huh-7. [0003] The SARS-CoV-2 genome contains approximately 29,000 bases, with 12 protein coding regions or open reading frames (ORFs), including 1ab, S, 3, E, M, 7, 8, 9, 10b, N, 13 , 14; wherein ORF 1ab is the region where the RNA-dependent RNA polymerase gene (RdRp) is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/00C12N15/867C12Q1/70C12Q1/6851C12Q1/6844C12N15/11C12R1/93
CPCC12N7/00C12N15/86C12N2740/15043C12N2770/20021C12Q1/6844C12Q1/6851C12Q1/701C12Q2600/16C12Q2545/113C12Q2563/107C12Q2521/507C12Q2522/101
Inventor陈孝宇陈鑫周旋徐家文
Owner武汉海关技术中心