Ces2 gene knockout rat model and construction method and application thereof

A rat model, gene knockout technology, applied in the field of biomedicine, can solve problems such as the complexity of the Ces2 gene

Active Publication Date: 2020-09-11
EAST CHINA NORMAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the complexity of the Ces2 gene in rats and mice, there is currently n

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ces2 gene knockout rat model and construction method and application thereof
  • Ces2 gene knockout rat model and construction method and application thereof
  • Ces2 gene knockout rat model and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0104] Embodiment 1 target design

[0105] The CRISPR / Cas9 system can recognize the DNA sequence at the end of NGG in the genome corresponding to the guide RNA, so the present invention selects a nucleotide sequence with a length of 18 bp at the 5' end of NGG in the genome as the knockout target. In order to cause the gene to undergo frameshift mutation to the greatest extent, the principle of selecting the knockout target in the present invention is to be as close as possible to the 5' end of the genome. The CRISPR / Cas9 system may have a mismatch of 1 to 3 bases, so the present invention will perform off-target detection on the designed target. The off-target detection website is: https: / / benchling.com.

[0106] The rat Ces2 gene knockout target designed by the present invention is as follows:

[0107] The knockout targets of Ces2a are TTGGCTAGACTTCCTGG (SEQ ID NO.1)T and TTCCCTCCAGCATGTGCA (SEQ ID NO.2), followed by TGG and CGG respectively. The target is located on the fir...

Embodiment 2

[0109] Example 2 Synthesis and transcription of sgRNA template

[0110] In the present invention, rat fertilized eggs are selected for microco-injection of sgRNA and Cas9 mRNA to realize gene editing of the rat Ces2 gene. The present invention first synthesizes a 60bp oligonucleotide sequence containing a T7 promoter and a 18bp target sequence, and uses the sequence as a template to obtain a complete sgRNA double-stranded template sequence by overlapping PCR technology. The template was transcribed in vitro with the T7 in vitro transcription kit, and sgRNA was obtained after extraction and purification with phenol-chloroform.

[0111] The synthetic 60bp oligonucleotide sequence of the present invention is as follows:

[0112] Ces2a

[0113] GATCACTAATACGACTCACTATAGG GCCTTTGGCTAGACTTCC GTTTTAGAGCTAGAAAT (SEQ ID NO. 5)

[0114] GATCACTAATACGACTCACTATAGG TCTCCTCCAGCATGTGCA GTTTTAGAGCTAGAAAT (SEQ ID NO. 6)

[0115] Ces2c

[0116] GATCACTAATACGACTCACTATAGG CGGAAACAACCACAT...

Embodiment 3

[0119] Example 3 Genotype Identification of Ces2 Gene Knockout Rats

[0120] In the present invention, the offspring bred by pseudopregnant female mice are called the F0 generation, and the offspring produced by crossing the F0 generation rats with non-three integer multiple gene editing at a single site and the wild-type rats are the F1 generation, and the F1 generation rats of the same genotype are large The offspring obtained by crossing mice is the F2 generation. The F1 generation is heterozygous selfing, so it is possible to produce wild-type, heterozygous and homozygous knockout F2 generation rats. The genetic background of these rats has little difference, which is conducive to the development of subsequent experiments.

[0121] Genotype identification of F0 generation rats. Design the primers required for PCR in the upstream and downstream of the target site, and use the F0 generation rat genome as a template to perform the PCR reaction of the Taq enzyme system to obt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a construction method and application of a Ces2 knockout rat model for drug metabolism research. The construction method of the Ces2 knockout rat model comprises the steps of gene knockout target selection, sgRNA synthesis, embryo microinjection, rat feeding and reproduction and the like. The homozygote Ces2 gene knockout rat model is obtained; and then Ces2 expression detection and metabolic function verification are performed on the homozygous Ces2 gene knockout rat model from the mRNA level to prove that the Ces2 gene knockout rat model is successfully constructed. ACes2a/j gene knockout rat model, the Ces2c gene knockout rat model and a Ces2a/c/j gene knockout rat model are successfully constructed through the method, and the models can serve as important toolsfor researching Ces2-related drug metabolism and are important animal models for researching Ces2 physiological functions.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a construction method and application of carboxylesterase 2 (Ces2) gene knockout rats. Background technique [0002] Carboxylesterase (CES) is an α / β serine folded protein, which contains multiple genes and belongs to class B esterases. It plays an important role in the biotransformation of various endogenous and exogenous substances and the activation of prodrugs. It is mainly distributed in the liver and intestinal tract, and also in a small amount in organs such as kidney, lung and brain. It is an important phase I drug in the human body. metabolic enzymes. CES1 and CES2, as the main subtype carboxylesterases, have 47% amino acid sequence similarity, but they have a clear tendency to substrate selection. CES1 substrates mostly have larger acyl groups and smaller alcohol groups, while CES2 tends to select compounds with smaller acyl groups and larger alcohol g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/90C12N15/89C12N15/113A01K67/027A01K67/02C12N15/11C12N5/071A61K49/00C12Q1/02
CPCC12N15/907C12N15/89A01K67/0276A01K67/02C12N15/1137C12N9/18C12Y301/01001C12N5/067A61K49/0008G01N33/5076A01K2217/075A01K2227/105A01K2217/15A01K2267/03
Inventor 王昕尚旭阳鲁健张远金
Owner EAST CHINA NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap