Ces2 gene knockout rat model and construction method and application thereof
A rat model, gene knockout technology, applied in the field of biomedicine, can solve problems such as the complexity of the Ces2 gene
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0104] Embodiment 1 target design
[0105] The CRISPR / Cas9 system can recognize the DNA sequence at the end of NGG in the genome corresponding to the guide RNA, so the present invention selects a nucleotide sequence with a length of 18 bp at the 5' end of NGG in the genome as the knockout target. In order to cause the gene to undergo frameshift mutation to the greatest extent, the principle of selecting the knockout target in the present invention is to be as close as possible to the 5' end of the genome. The CRISPR / Cas9 system may have a mismatch of 1 to 3 bases, so the present invention will perform off-target detection on the designed target. The off-target detection website is: https: / / benchling.com.
[0106] The rat Ces2 gene knockout target designed by the present invention is as follows:
[0107] The knockout targets of Ces2a are TTGGCTAGACTTCCTGG (SEQ ID NO.1)T and TTCCCTCCAGCATGTGCA (SEQ ID NO.2), followed by TGG and CGG respectively. The target is located on the fir...
Embodiment 2
[0109] Example 2 Synthesis and transcription of sgRNA template
[0110] In the present invention, rat fertilized eggs are selected for microco-injection of sgRNA and Cas9 mRNA to realize gene editing of the rat Ces2 gene. The present invention first synthesizes a 60bp oligonucleotide sequence containing a T7 promoter and a 18bp target sequence, and uses the sequence as a template to obtain a complete sgRNA double-stranded template sequence by overlapping PCR technology. The template was transcribed in vitro with the T7 in vitro transcription kit, and sgRNA was obtained after extraction and purification with phenol-chloroform.
[0111] The synthetic 60bp oligonucleotide sequence of the present invention is as follows:
[0112] Ces2a
[0113] GATCACTAATACGACTCACTATAGG GCCTTTGGCTAGACTTCC GTTTTAGAGCTAGAAAT (SEQ ID NO. 5)
[0114] GATCACTAATACGACTCACTATAGG TCTCCTCCAGCATGTGCA GTTTTAGAGCTAGAAAT (SEQ ID NO. 6)
[0115] Ces2c
[0116] GATCACTAATACGACTCACTATAGG CGGAAACAACCACAT...
Embodiment 3
[0119] Example 3 Genotype Identification of Ces2 Gene Knockout Rats
[0120] In the present invention, the offspring bred by pseudopregnant female mice are called the F0 generation, and the offspring produced by crossing the F0 generation rats with non-three integer multiple gene editing at a single site and the wild-type rats are the F1 generation, and the F1 generation rats of the same genotype are large The offspring obtained by crossing mice is the F2 generation. The F1 generation is heterozygous selfing, so it is possible to produce wild-type, heterozygous and homozygous knockout F2 generation rats. The genetic background of these rats has little difference, which is conducive to the development of subsequent experiments.
[0121] Genotype identification of F0 generation rats. Design the primers required for PCR in the upstream and downstream of the target site, and use the F0 generation rat genome as a template to perform the PCR reaction of the Taq enzyme system to obt...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


