Self-assembled nano material as well as preparation method and application thereof

A nanomaterial, self-assembly technology, applied in the field of biomimetic catalytic materials, can solve the problems of variability, protein structure unfolding, active structure destruction, etc., and achieve the effect of low price

Active Publication Date: 2020-09-22
BEIJING UNIV OF CHEM TECH
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, as a natural protein, laccase still has significant disadvantages, that is, it is easy to denature
Under high temperature or extremely acidic, extremely alkaline and other environments, the protein structure of laccase is prone to unfolding, resulting in the destruction of the active structure and irreversible loss of activity
This largely limits the application of laccases in industrial environments; for example, in the high-temperature wastewater in the printing and dyeing industry, the activity of laccases is severely inhibited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Self-assembled nano material as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] (1) Preparation of self-assembly mimetic enzymes

[0028] To 96 μL 50 mM Na 2 HPO 4 / NaH 2 PO 4 Add 1 μL of 100 μM G-DNA, 2 μL of 1 mg / mL Fmoxy-lysine and 1 μL of 1000 μM CuCl to the buffer solution (pH 7.0) 2 , samples were added at intervals of 10 s, followed by mixing at 25 °C for 30 min. Wherein, the sequence of G-DNA is GGGTAGGGCGGGCGGG (SEQ ID NO.1), which is purified by HPLC (high performance liquid chromatography) or PAGE (polyacrylamide gel electrophoresis).

[0029] (2) Catalytic activity test

[0030] Add 1 μL of 100 mM tetramethylbenzidine (dissolved in DMSO) to 100 μL of simulated enzyme solution sequentially, the interval between sample additions is 5 s, and record the absorbance at 652 nm (the oxidation intermediate product of tetramethylbenzidine) over time. Change, through the molar extinction coefficient of the oxidation product of tetramethylbenzidine (39000M cm -1 ), calculate the oxidation rate of tetramethylbenzidine. The switching number o...

Embodiment 2

[0032] To 90 μL 50 mM K 2 HPO 4 / KH 2 PO 4 Add 1 μL of 1000 μM G-DNA, 8 μL of 200 mM peptide and 1 μL of 500 μM CuCl to the buffer solution (pH 7.0) 2 , samples were added at intervals of 10 s, followed by mixing at 25 °C for 30 min. Wherein, the sequence of G-DNA is GGTAGGCGGCGGTGGCGGCGGAGG (SEQ ID NO.2), purified by HPLC or PAGE; the sequence of polypeptide is phenylalanine-lysine-lysine, purified by HPLC.

[0033] (2) Catalytic activity test

[0034] Add 1 μL of 100 mM phenol (dissolved in DMSO) and 1 μL of 200 mM 4-aminoantipyrine solution to 100 μL of simulated enzyme solution in sequence. Pyrine dye) with time, through the molar extinction coefficient of indoxyl amino antipyrine dye, calculate the oxidation rate of phenol. The switching number on the copper ion surface is 0.65s -1 , the catalytic oxidation rate is 7.85mM -1 the s -1 .

Embodiment 3

[0036] (1) To 90 μL of 50 mM MES / MES sodium salt buffer solution (pH 7.0, containing 50 mM NaCl), sequentially add 5 μL of 200 mM guanosine-5′-monophosphate disodium salt, 4 μL of 2 mM polypeptide and 1 μL of 1000 μM CuCl 2 , samples were added at intervals of 10 s, followed by mixing at 20 °C for 30 min. Wherein, the sequence of the polypeptide is phenylalanine-lysine-phenylalanine-lysine, and is purified by HPLC.

[0037] (2) Catalytic activity test

[0038] Add 1 μL of 100 mM 2,4-dichlorophenol (dissolved in DMSO) and 1 μL of 200 mM 4-aminoantipyrine solution to 100 μL of simulated enzyme solution in sequence. Indoxyl amino antipyrine dye) changes with time, through the molar extinction coefficient of indoxyl amino antipyrine dye, calculate the oxidation rate of 2,4-dichlorophenol. The switching number on the copper ion surface is 0.22s -1 , the catalytic oxidation rate is 1.64mM -1 the s -1 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a self-assembled nano material. formed by nucleic acid or nucleotide, an amino acid derivative or polypeptide and copper ions through self-assembly. The type of the amino acidderivative is lysine, histidine, methionine or cysteine; the chiral configuration is L-shaped or D-shaped; the polypeptide contains histidine, methionine, lysine or cysteine; the length of the peptideis 2 peptide-40 peptide; the nucleic acid is DNA; the molar ratio of guanine deoxynucleotide in DNA is 10%-100%, the total number of the nucleotides is 4-59, and the nucleotide is guanosine-5'-monophosphate, adenosine-5'-monophosphate, cytidine-5'-monophosphate, uridine-5'-monophosphate, deoxyguanosine-5'-monophosphate, deoxyadenosine-5'-monophosphate, deoxycytidine-5'-monophosphate or thymidine-5'-monophosphate. According to the invention, the simulated enzyme catalytic reaction can be monitored through a light absorption or fluorescence photometer.

Description

technical field [0001] The invention belongs to the field of bionic catalytic materials, and relates to a self-assembled nanometer material and its preparation method and application. Background technique [0002] Phenolic pollutants in the environment mainly come from three aspects: (1) industrial synthetic waste, such as gas, petrochemical, wood fiber, pesticide, paint, and printing and dyeing textile wastewater and paper industry bleaching wastewater; (2) agricultural Production, such as the extensive use of 2,4-dichlorophenol and 2,4,5-trichlorophenol) and the wide application of chlorophenol compounds in fungicides and herbicides; (3) Degradation of certain organic substances. Phenolic compounds are toxic and have strong toxicity, teratogenicity and multiple neuropathy effects on organisms in the environment. Although their content is low, they are active, refractory and accumulative, and have been listed by many countries. included in the list of key pollutants. How ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): B01J31/22B82Y30/00B82Y40/00C02F3/34C02F101/34C02F103/30
CPCB01J31/2217B82Y30/00B82Y40/00C02F3/342C02F2101/345C02F2103/30Y02P20/55
Inventor王振刚
OwnerBEIJING UNIV OF CHEM TECH