Saccharomyces cerevisiae recombinant bacteria and construction method and application thereof

A technology for Saccharomyces cerevisiae and a construction method, which is applied in the field of Saccharomyces cerevisiae recombinant bacteria and its construction, and can solve the problems of low enzyme catalysis efficiency of exogenous pathway and the like

Active Publication Date: 2020-10-30
YANGZHOU UNIV
View PDF7 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Insufficient supply of precursors and low catalytic efficiency of exogenous pathway enzymes are the main reasons for limiting caffeic acid synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharomyces cerevisiae recombinant bacteria and construction method and application thereof
  • Saccharomyces cerevisiae recombinant bacteria and construction method and application thereof
  • Saccharomyces cerevisiae recombinant bacteria and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1 Recombinant plasmid construction required for caffeic acid synthesis

[0063] Firstly, the genome of Salmonella enteritidis C50336 (a gift from Teacher Gu Dan, School of Biological Science and Technology, Yangzhou University) was used as a template, and HpaC-F (EcoR I) (GCGGAATTCATGCAAGTAGATG AACAACGT) and HpaC-R (Bgl II) (CCTTAGATCTTTAAACAGGCGCTTCCATC TC) were used as primers , amplified the HpaC gene ( image 3 ), and then perform double digestion with EcoR I and Bgl II, and the obtained fragment is ligated with the pUMRI-13 (GenBank: KM216415.1) plasmid that was also digested with EcoR I and Bgl II for transformation, and pUMRI-13-HpaC was constructed plasmid.

[0064] The PCR reaction system is as follows:

[0065]

[0066] The PCR program is as follows:

[0067]

[0068] The plasmid or gene fragment digestion system is as follows:

[0069]

[0070]

[0071] 37°C, enzyme digestion for 2h. The digested product was separated by 1.0% agarose ...

Embodiment 2

[0077] The construction of embodiment 2 caffeic acid production strain

[0078] The recombinant vector pUMRI-13-HpaB-HpaC contains a Sfi I site, and for the first time the vector was linearized by Sfi I digestion.

[0079] Enzyme digestion system: total system 50 μL, plasmid 43.5 μL, 10×Quick Cut Buffer 5 μL, Quick cut SfiI enzyme 1.5 μL.

[0080] Digestion conditions: place at 50°C for 2-3 hours.

[0081]The linearized plasmid pUMRI-13-HpaB-HpaC was introduced into Saccharomyces cerevisiae YXWP-113, and a positive recombinant yeast was obtained by screening with a YPD plate containing G418 resistance, which was named YCA113-1B. Since pUMRI-13-HpaB-HpaC contains URA3 and KanMX (encoding Geneticin G418 resistance in yeast) dual selectable markers, where URA3 encodes orotidine 5-phosphate dehydrogenase (orotidine 5-phosphate decarboxylase), the The enzyme catalyzes a key reaction in the synthesis of yeast RNA pyrimidine nucleotides. When 5-fluoroorotic acid (5-FOA) is added t...

Embodiment 3

[0082] Example 3 Analysis and Detection of Caffeic Acid Yield

[0083] Cultivate the starting strain YXWP-113 and the engineering strain YCA113-2B in the YPD shaker flask according to the culture method of S. Add 2 mL of purified water to wash the cells, centrifuge at 12,000×g for 1 minute, remove the supernatant, and place the centrifuge tube in an oven at 100°C to dry to constant weight for dry weight measurement.

[0084] And follow the steps below for sample processing and yield analysis:

[0085] (1) Transfer 1 mL of fermentation broth to a 1.5 mL EP tube, and centrifuge at 12,000×g for 1 min at room temperature.

[0086] (2) Take 50 μL of supernatant to a new 1.5 mL EP tube, add 950 μL of purified water to dilute 20 times.

[0087] (3) Filter with a 0.22 μm water-based needle filter to obtain samples for caffeic acid determination.

[0088] Quantitative analysis of caffeic acid: samples were analyzed by Agilent 1200 high performance liquid chromatography. The chromat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a saccharomyces cerevisiae recombinant bacterium. According to the saccharomyces cerevisiae recombinant bacterium, an RgTAL gene, an HpaB gene and an HpaC gene are integrated in a genome. The invention further discloses a construction method and application of the saccharomyces cerevisiae recombinant bacteria. The invention finally discloses a production method of caffeic acid. According to the invention, three exogenous genes required by caffeic acid synthesis are integrated into saccharomyces cerevisiae chromosomes; total synthesis from glucose to caffeic acid is achieved through knockout of competitive pathway genes, elimination of feedback inhibition steps and overexpression of rate-limiting enzymes, the shake flask yield reaches about 760 mg / L, the shake flaskyield is the highest level of the yeast yield reported at present, and a new method is provided for industrial production of caffeic acid.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to a recombinant saccharomyces cerevisiae and its construction method and application. Background technique [0002] Caffeic acid is a secondary metabolite widely distributed in plants. It not only has biological activities such as antibacterial and disease resistance, but also is an important raw material and intermediate of medicine. At present, the main sources of caffeic acid are chemical synthesis and plant extraction. The chemical synthesis of caffeic acid has problems such as many synthesis steps, complicated process, and unfriendly environment. However, the yield of plant extraction is low and the price is expensive. With the development of synthetic biology technology, the use of microbial fermentation to produce caffeic acid has become an important option. [0003] Existing patents (CN 108949652 A) reported that caffeic acid was produced by glucose ferme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/19C12N15/81C12P7/42C12R1/865
CPCC12N15/81C12N9/88C12N9/0071C12N9/001C12Y403/01025C12Y114/14009C12Y103/08C12P7/42Y02E50/10
Inventor周萍萍岳春磊杜艺
OwnerYANGZHOU UNIV