R-loop binding protein GST-His6-1/2*HBD and whole genome R-loop detection method

A technology that combines proteins and detection methods, applied in the field of nucleic acid omics, can solve the problems of cumbersome operation steps, poor signal background, and long experiment cycle, and achieve the effects of improved detection efficiency, high signal-to-noise ratio, and easy operation

Active Publication Date: 2020-12-22
WUHAN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although these methods have brought the detection of R-rings into the era of genomics, there are great differences in the whole-genome maps of R-rings mapped by different detection strategies
In addition, these methods have shortcomings such as long experimental period, cumbersome operation steps, and poor signal background, and cannot form a "gold standard" for R-ring positioning in the field.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • R-loop binding protein GST-His6-1/2*HBD and whole genome R-loop detection method
  • R-loop binding protein GST-His6-1/2*HBD and whole genome R-loop detection method
  • R-loop binding protein GST-His6-1/2*HBD and whole genome R-loop detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] [Example 1] Recombinant plasmid GST-His 6 -1 / 2 x HBD build

[0040] 1. Design and synthesis of primers

[0041] According to the high homology of RNase H1 among different species provided by Marcin Nowotny et al. (2008), the ppyCAG-RNASEH1-D210N plasmid (addgene#111904) containing human RNase H1 coding sequence was purchased from addgene, and designed according to the plasmid information Synthetic specific primers amplify the HBD domain. Five glycine repeat sequences were added to one primer to express a flexible linker to promote tandem HBD protein expression. The primers were synthesized by Shanghai Sangon Bioengineering Technology Co., Ltd., and the sequences and numbers of each primer are as follows:

[0042] (1) HBD gene amplification primers

[0043] LP-1:

[0044] GCCATATCGAAGGTCGTCATATGATGTTCTATGCCGTGAGGAGGGGC

[0045] RP-1:

[0046] CTTTGTTAGCAGCCGGTTATCCCCCTCCGCCTCCGCTTGCAGATTTCCT

[0047] GACAAAGGC

[0048] (2) 2×HBD gene amplification primers

[00...

Embodiment 2

[0055] [Example 2] GST-His 6 -1 / 2×HBD protein expression and purification

[0056] 1.GST-His 6 -1 / 2 x HBD protein expression

[0057] GST-His 6 -1 / 2×HBD recombinant plasmid transformed into T7 Express lysY / I q Competent cells, after resistance screening, selected monoclonal strains were cultured in 2×YT medium containing 100 μg / mL ampicillin sodium, and the bacterial culture conditions were set at 37°C and the rotation speed was 200rpm. when the bacterial OD 600 When 0.6 was reached, protein expression was induced by adding 0.5 mM IPTG. Bacteria particles were collected by centrifugation after cultivating for 5 hours, excess culture medium was removed, and lysis HEX buffer solution (components including 20mM HEPES, 0.8M sodium chloride, 10% glycerol, 0.2% Triton X-100, 1X protease inhibition) was added at pH 7.5 agent). Mix the buffer and the bacteria thoroughly, then use a cell disruptor to perform high-pressure disruption, break at 4°C and 800psi for 5 minutes, and th...

Embodiment 3

[0060] [Example 3] GST-His 6 -1 / 2×HBD protein specifically recognizes the R-loop structure

[0061] (1) Gel electrophoresis mobility assay (EMSA) to detect different concentrations of GST-His 6 The binding ability of -1 / 2×HBD protein and DNA:RNA hybrid, the reaction conditions and system are as follows:

[0062]

[0063] Mix the above components with a pipette, and perform the following reaction on a PCR thermal cycler: incubate at 25°C for 30 minutes

[0064] (2) Add the sample in step (1) to 6% TBE-PAGE gel for electrophoresis, the electrophoresis buffer is 0.5×TBE, the electrophoresis voltage is set to 60V, and the electrophoresis time is 60 minutes.

[0065] (3) Use GE's Typhoon9500 to scan the gel, and verify GST-His according to the blocking phenomenon of nucleic acid in the gel 6 -1 / 2×HBD protein can specifically bind to DNA:RNA hybrids, see the specific results image 3 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an R-loop binding protein GST-His6-1 / 2*HBD and whole genome R-loop detection method. The GST-His6-1 / 2*HBD protein can be used for binding and positioning an R-loop, and is prepared by the following steps of construction and extraction of recombinant plasmid GST-His6-1 / 2*HBD; transferring the recombinant plasmid into a T7Express lysY / Iq competent cell, performing culturing ina 2*YT culture medium, and inducing protein expression by using IPTG; and carrying out affinity purification on the GST-His6-1 / 2*HBD protein by using Ni-NTA beads. The R-Loop CUT*TAG which has a small number of cells, is simple and convenient to operate and has a higher signal-to-noise ratio is developed by using cleavage under targets and tagmentation by virtue of the specific binding capacity on the R-loop structure, so that an endogenous R-loop genome map can be better drawn, and the function of an R-loop in a genome is explained.

Description

technical field [0001] The invention belongs to the field of nucleic acid omics, in particular to an R-loop binding protein GST-His 6 -1 / 2×HBD and genome-wide R-loop detection methods. Background technique [0002] R-loop (R-Loop) is a special three-stranded nucleic acid structure formed by RNA invasion into double-stranded DNA, including a DNA: RNA hybrid strand and a single-stranded DNA (single strand DNA, ssDNA). At first, the R-loop was considered to be a by-product of the transcription process, but in recent years, research has found that the R-loop exists widely in bacteria, yeast, and mammalian cells, and participates in the regulation of the entire cell cycle, and is involved in gene expression and chromatin structure stability. It plays a key role in the process of DNA damage repair. Corresponding to the function of R-loop in transcriptional regulation and DNA damage repair, R-loop has also been reported to be related to many diseases in recent years, such as neur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/22C07K19/00C12N15/70C12Q1/6804C12R1/19
CPCC12N9/22C12Y301/26004C12N15/70C12Q1/6804C07K2319/23C07K2319/21C12Q2521/50C12Q2525/191C12Q2531/119C12Q2535/122
Inventor梁凯威王康王红红李聪慧
OwnerWUHAN UNIV