Check patentability & draft patents in minutes with Patsnap Eureka AI!

Saccharomyces cerevisiae genetically engineered bacterium for synthesizing lycopene as well as construction method and application of saccharomyces cerevisiae genetically engineered bacterium

A technology of genetically engineered bacteria and Saccharomyces cerevisiae is applied to the genetic engineering bacteria of Saccharomyces cerevisiae for synthesizing lycopene and its construction field, and can solve the problems of many by-products, difficult chemical synthesis, low accumulation of lycopene and the like

Pending Publication Date: 2021-05-18
NANJING NORMAL UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide a Saccharomyces cerevisiae genetically engineered strain for synthesizing lycopene, so as to solve the problems of low accumulation of lycopene in plants, difficult chemical synthesis and many by-products in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharomyces cerevisiae genetically engineered bacterium for synthesizing lycopene as well as construction method and application of saccharomyces cerevisiae genetically engineered bacterium
  • Saccharomyces cerevisiae genetically engineered bacterium for synthesizing lycopene as well as construction method and application of saccharomyces cerevisiae genetically engineered bacterium
  • Saccharomyces cerevisiae genetically engineered bacterium for synthesizing lycopene as well as construction method and application of saccharomyces cerevisiae genetically engineered bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044]Embodiment 1: Construction of lycopene biosynthetic pathway:

[0045] 1. Construction of inducible fusion protein module plasmid

[0046] The crtE, crtB, and crtI genes were codon-optimized and primers were designed using the software Vector NTI 9.0, and the optimized genes were used as templates, according to figure 1 As shown, crtI and recombinant fragment I were sequentially amplified ( figure 2 ), the crtI gene and the recombinant fragment I were respectively connected to the plasmid pESC-Leu and pESC-I by the method of BamHI / HindIII and SpeI / SacI double enzyme digestion-ligation, and the recombinant plasmid pESC-I and the fusion protein module were obtained Plasmid pEBI.

[0047] Recombinant fragment I is an inducible fusion protein module, and crtE and crtB are fused and connected by homologous recombination (remove the TAA on the crtE gene, and add the Linker sequence of 5'-GGTGGTGGTGGTTCTGGTGGTGGTGGTTCA-3').

[0048] The primer sequences are:

[0049] IF: TA...

Embodiment 2

[0080] Example 2: Verification of the expression of key carotenoid enzymes by recombinant strains to produce lycopene.

[0081] YPD medium: 10g / L yeast extract powder, 20g / L peptone, 20g / L glucose.

[0082] YPG medium: 10g / L yeast extract powder, 20g / L peptone, 20g / L galactose.

[0083] SD-Leu medium: 6.7g / L amino-free yeast nitrogen source (YNB), 20g / L glucose, 0.69g / L CSM-Leu.

[0084] SG-Leu medium: 6.7g / L amino-free yeast nitrogen source (YNB), 20g / L galactose, 0.69g / L CSM-Leu.

[0085] Inoculate positive clones into 50mL SD-Leu liquid medium, place on a shaker at 30°C, and cultivate at 200rpm until the OD600 value is about 4-6. Centrifuge at 4000r / min for 10min, collect all the bacteria, and transfer all the bacteria into Continue to culture in 50mL SG-Leu and YPG medium or fresh SD-Leu and YPD medium for 48-96h. After the bacterial cell culture was completed, the bacterial cells were collected by centrifugation at 5000 rpm for 10 min at 4°C, washed twice with distille...

Embodiment 3

[0086] Example 3: Analysis of mRNA content of lycopene synthesis gene.

[0087] The TRIzol method was used to extract the total RNA in the 48-96h fermentation of the recombinant bacteria, and the RNA was reverse-transcribed into cDNA, and the cDNA was used as a template to design corresponding primers for the determination of fluorescent quantitative PCR. Each sample was repeated 3 times. 18SrRNA gene was selected as the internal reference gene, and 2 -△△Ct method to analyze the data. Comparison of gene expression in different strains Figure 6 , Figure 7 .

[0088] The primer sequences are:

[0089] crtB-F: TGGTTTTATGGTTGCTCC

[0090] crtB-R:CCAAGTCACCCAAATGTCT

[0091] crtE-F: TGGTGTTCCAGTTGCTAT

[0092] crtE-R: GTTGACCTTCTGCTGTTCT

[0093] crtI-F: CAGCTCCATCACCATACAC

[0094] crtI-R: CTAATACCCCAAAGCCAAAC

[0095] crtEB-F:GCTGCTCCAGATCCACAA

[0096]crtEB-R:AGCGTAAACTGCCCAAAC

[0097] 18S-F: GTTGGTGGAGTGATTTGTCTGC

[0098] 18S-R: GCACGACGGAGTTTCACAAGAT

[0099...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a saccharomyces cerevisiae genetically engineered bacterium for synthesizing lycopene, and belongs to the technical field of microbial genetic engineering. According to the invention, crtE, crtB and crtI genes derived from Deinococcus wulumuqiensis R12 are co-expressed in saccharomyces cerevisiae, the nucleotide sequence of the crtE is as shown in SEQ ID NO. 1; the nucleotide sequence of the crtB is as shown in SEQ ID NO. 2; and the nucleotide sequence of the crtI is as shown in SEQ ID NO. 3. According to an expression strategy used in the invention, efficient synthesis of the lycopene is realized in the saccharomyces cerevisiae, an engineering bacterium host suitable for producing terpenoids is screened out, and a foundation is laid for further optimizing artificially synthesized cells to produce the lycopene.

Description

technical field [0001] The invention belongs to the technical field of microbial genetic engineering, and in particular relates to a Saccharomyces cerevisiae genetically engineered bacterium for synthesizing lycopene, a construction method and application thereof. Background technique [0002] Lycopene (lycopene) is a typical oxygen-free carotenoid, which is dark red in color and has strong antioxidant capacity. It can efficiently remove active oxygen free radicals, effectively delay aging and reduce the prevalence of various diseases. gradually become a research hotspot. Currently, the commonly used methods for producing lycopene include direct extraction, chemical synthesis and microbial fermentation. The raw material tomato of the direct extraction method is often affected by climate and season, resulting in high synthesis costs, while the synthesis process of the chemical synthesis method is cumbersome, and the residual problem of chemical reagents will further limit th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/81C12N15/53C12N15/54C12P5/02C12R1/865
CPCC12N9/1085C12N9/001C12N15/52C12N15/81C12P5/007C12Y205/01029C12Y205/01032C12Y103/99031
Inventor 徐娴刘洁兰海全顾万怡江凌张志东
Owner NANJING NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com