Check patentability & draft patents in minutes with Patsnap Eureka AI!

Rapid detection kit for pathogenic bacteria of phoma stem canker and using method of rapid detection kit

A detection kit and pathogenic bacteria technology, which is applied in the field of rapid detection kits for rapeseed blackleg pathogens, can solve the problem of unclear results, long time required, and inability to meet the requirements of rapid screening and detection of rapeseed blackleg pathogens. Detection and other issues, to achieve the effect of good specificity, short time-consuming, convenient and rapid detection and identification diagnosis

Active Publication Date: 2021-07-16
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For nucleic acid extracted from plant tissues with the same symptoms, the nucleic acid concentration of pathogenic bacteria is low, and ITS universal primers are often required for PCR amplification and sequencing, which takes a long time and the results are often unclear
[0004] Therefore, the current technology cannot meet the rapid screening and detection of rapeseed blackleg pathogen in the fields or ports in my country, especially the rapid, accurate and effective identification of strong pathogenic canker canker (Lm) and weak pathogenic type of rapeseed blackleg. leg bacteria (Lb), so there is an urgent need for relevant detection methods with good specificity and high sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rapid detection kit for pathogenic bacteria of phoma stem canker and using method of rapid detection kit
  • Rapid detection kit for pathogenic bacteria of phoma stem canker and using method of rapid detection kit
  • Rapid detection kit for pathogenic bacteria of phoma stem canker and using method of rapid detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0108] Example 1 Rapid Detection Kit and Application Method of Rapeseed Blackleg Pathogenic Bacteria

[0109] The rapid detection kit of the rapeseed blackleg pathogenic bacteria is used to detect the rapeseed canker bacterium (Lm) or the rapeseed black stem pathogen (Lb); the rapid detection kit of the rapeseed blackleg pathogenic bacteria includes a fluorescent Detection kit or colloidal gold test strip detection kit;

[0110] The fluorescence detection kit includes: 10×Buffer 2 μL, RNase Inhibitors (40U / μL) 0.3-1.0 μL, DTT 0.3-1.0 μL, Cas12a (1 μM) 2-5 μL, Lm crRNA or Lb crRNA (1 μM) 2-4 μL , FQ reporter (1μM) or FB reporter (5μM) 1-4μL, Lm or Lb amplification product 1-3μL; H 2 O (RNAase free Up to 20 μL;

[0111] The Cas12a cutting recognition site is TTTN;

[0112] The Lm crRNA is any one or several in Table 1 (12 kinds);

[0113] The Lb crRNA is any one or several in Table 4 (in 12);

[0114] The FQ reporter is a fluorophore-TTTATTT-quenching fluorophore; the fluorop...

Embodiment 2

[0131] Embodiment 2: Rapeseed stem base canker pure bacteria detection

[0132] In embodiment 2 and 3: the isothermal amplification kit can adopt TwistAmp company's Basic kit, RPA or RAA nucleic acid amplification kit produced by other companies in China can also be used; crRNA in vitro transcription reagent T7Transcript Kit, Lba Cas12a (Cpf1) nuclease was purchased from NEB Company, RNA purification magnetic beads were purchased from Beckman; the magnetic bead method plant genomic DNA extraction kit was purchased from Beijing Tiangen; the rapid extraction reagent was NaOH-based reagent; primer nucleic acid, FQ reporter Synthesized with FB reporter probe by Shanghai Sangong;

[0133] In this example, the pretreated nucleic acid was obtained by using a magnetic bead method plant genomic DNA extraction kit or a rapid nucleic acid release agent.

[0134] 2.1 Nucleic acid preparation

[0135] Using the magnetic bead method plant genome DNA extraction kit to extract fungal hyp...

Embodiment example 3

[0170] Implementation Case 3: Rapid Detection of Rapeseed Blackleg Pathogen L.bioglobosa (Lb)

[0171] This implementation case demonstrates the rapid detection of the rapeseed blackleg pathogen L. bioglobosa using Cas12a of the present invention.

[0172] 3.1 Nucleic acid preparation

[0173] Using the magnetic bead method plant genome DNA extraction kit to extract the nucleic acid of the mycelium of rapeseed black shank pathogen.

[0174] 3.2 Nucleic acid amplification

[0175] Using the RPA amplification primers Lb-F and Lb-R, referring to the RPA isothermal amplification operation steps, amplified to obtain the sample to be detected.

[0176] The nucleotide sequence of the Lb-specific primer is:

[0177] Lb-F:CCAACACAGGCTTAAGAAATCCGCCCCAGA (SEQ ID NO: 27);

[0178] Lb-R: CCGTGCCTTGACTCTGCTGCCCGTGCCAAG (SEQ ID NO: 28);

[0179] In the case of sensitivity detection, 1.5ng of Lb genomic DNA nucleic acid was diluted 10 times.

[0180] use The basic kit method for nucle...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a rapid detection kit for pathogenic bacteria of phoma stem canker and a using method of the rapid detection kit. The rapid detection kit comprises a rapid detection method and a kit for leptosphaeria maculans and leptosphaeria biglobosa. The detection method for the pathogenic bacteria comprises specific amplification of target nucleic acid molecules and specific detection based on specific guide RNA, Cas12a and a nucleic acid probe. By using the method provided by the invention, whether the leptosphaeria maculans and the leptosphaeria biglobosa are contained in rape plant tissues can be rapidly detected. In combination with a nucleic acid isothermal amplification technology, the sensitivity of the detection method can be greatly improved, and the detection method can be used in fields and quarantine sites. The rapid detection kit for the pathogenic bacteria of the phoma stem canker is used for detecting the leptosphaeria maculans or leptosphaeria biglobosa, has the advantages of high sensitivity, good specificity, short consumed time, no dependence on large experimental equipment and the like, and is conveniently used for field disease investigation as well as rapid detection and identification diagnosis of the pathogenic bacteria of the phoma stem canker in primary laboratories.

Description

technical field [0001] The invention relates to the technical fields of agriculture and plant quarantine, in particular to a rapid detection kit for rapeseed blackleg pathogenic bacteria and a use method thereof. Background technique [0002] Rapeseed blackleg (Phoma stem canker) is one of the most serious fungal diseases on rapeseed, which can cause damage to rapeseed stems, seeds, leaves and roots, and seriously affect the growth of rapeseed and the yield of rapeseed. There are currently two types of fungi that can cause rapeseed blackleg, one is the strong pathogenic type Leptosphaeria maculans (Lm), the other is the weakly pathogenic type Leptosphaeria biglobosa (Lb), It is a compound species of the genus Micrococcomus. Rapeseed canker is highly pathogenic and can cause canker at the base of rapeseed, which can lead to 30%-50% or even higher yield reduction in severe cases. It is the main factor leading to the prevalence and yield loss of rapeseed black leg disease[1 ]...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/6844C12N15/11G01N33/569G01N33/543
CPCC12Q1/6895C12Q1/6844G01N33/56961G01N33/54313C12Q2521/327C12Q2525/161
Inventor 雷荣吴品珊李明福
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More