Rapid detection kit for pathogenic bacteria of phoma stem canker and using method of rapid detection kit
A detection kit and pathogenic bacteria technology, which is applied in the field of rapid detection kits for rapeseed blackleg pathogens, can solve the problem of unclear results, long time required, and inability to meet the requirements of rapid screening and detection of rapeseed blackleg pathogens. Detection and other issues, to achieve the effect of good specificity, short time-consuming, convenient and rapid detection and identification diagnosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0108] Example 1 Rapid Detection Kit and Application Method of Rapeseed Blackleg Pathogenic Bacteria
[0109] The rapid detection kit of the rapeseed blackleg pathogenic bacteria is used to detect the rapeseed canker bacterium (Lm) or the rapeseed black stem pathogen (Lb); the rapid detection kit of the rapeseed blackleg pathogenic bacteria includes a fluorescent Detection kit or colloidal gold test strip detection kit;
[0110] The fluorescence detection kit includes: 10×Buffer 2 μL, RNase Inhibitors (40U / μL) 0.3-1.0 μL, DTT 0.3-1.0 μL, Cas12a (1 μM) 2-5 μL, Lm crRNA or Lb crRNA (1 μM) 2-4 μL , FQ reporter (1μM) or FB reporter (5μM) 1-4μL, Lm or Lb amplification product 1-3μL; H 2 O (RNAase free Up to 20 μL;
[0111] The Cas12a cutting recognition site is TTTN;
[0112] The Lm crRNA is any one or several in Table 1 (12 kinds);
[0113] The Lb crRNA is any one or several in Table 4 (in 12);
[0114] The FQ reporter is a fluorophore-TTTATTT-quenching fluorophore; the fluorop...
Embodiment 2
[0131] Embodiment 2: Rapeseed stem base canker pure bacteria detection
[0132] In embodiment 2 and 3: the isothermal amplification kit can adopt TwistAmp company's Basic kit, RPA or RAA nucleic acid amplification kit produced by other companies in China can also be used; crRNA in vitro transcription reagent T7Transcript Kit, Lba Cas12a (Cpf1) nuclease was purchased from NEB Company, RNA purification magnetic beads were purchased from Beckman; the magnetic bead method plant genomic DNA extraction kit was purchased from Beijing Tiangen; the rapid extraction reagent was NaOH-based reagent; primer nucleic acid, FQ reporter Synthesized with FB reporter probe by Shanghai Sangong;
[0133] In this example, the pretreated nucleic acid was obtained by using a magnetic bead method plant genomic DNA extraction kit or a rapid nucleic acid release agent.
[0134] 2.1 Nucleic acid preparation
[0135] Using the magnetic bead method plant genome DNA extraction kit to extract fungal hyp...
Embodiment example 3
[0170] Implementation Case 3: Rapid Detection of Rapeseed Blackleg Pathogen L.bioglobosa (Lb)
[0171] This implementation case demonstrates the rapid detection of the rapeseed blackleg pathogen L. bioglobosa using Cas12a of the present invention.
[0172] 3.1 Nucleic acid preparation
[0173] Using the magnetic bead method plant genome DNA extraction kit to extract the nucleic acid of the mycelium of rapeseed black shank pathogen.
[0174] 3.2 Nucleic acid amplification
[0175] Using the RPA amplification primers Lb-F and Lb-R, referring to the RPA isothermal amplification operation steps, amplified to obtain the sample to be detected.
[0176] The nucleotide sequence of the Lb-specific primer is:
[0177] Lb-F:CCAACACAGGCTTAAGAAATCCGCCCCAGA (SEQ ID NO: 27);
[0178] Lb-R: CCGTGCCTTGACTCTGCTGCCCGTGCCAAG (SEQ ID NO: 28);
[0179] In the case of sensitivity detection, 1.5ng of Lb genomic DNA nucleic acid was diluted 10 times.
[0180] use The basic kit method for nucle...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


