Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Helicobacter pylori HefC recombinant protein and application thereof

A technology of Helicobacter pylori and recombinant protein, which is applied in the field of genetic engineering, can solve the problems of increasing the difficulty of eradicating Helicobacter pylori infection, difficulty in group prevention and control, and low eradication rate, and achieves protection of immune titer, high-yield purification, The effect of high immune titer

Active Publication Date: 2021-07-23
CHENGDU OLYMVAX BIOPHARM
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The decline in the eradication rate of Helicobacter pylori is related to antibiotic resistance, strain virulence factor changes, and poor patient compliance, among which antibiotic resistance is the main influencing factor, and the limited availability of antibiotics also increases the difficulty of eradicating Helicobacter pylori infection
[0003] The development of an effective Helicobacter pylori vaccine can avoid the shortcomings of the current eradication methods such as low eradication rate, easy recurrence, and difficulty in group control of Helicobacter pylori in drug antibacterial therapy, and it will not be harmful to Helicobacter pylori and other diseases. Symbiotic bacteria generate more antibiotic resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Helicobacter pylori HefC recombinant protein and application thereof
  • Helicobacter pylori HefC recombinant protein and application thereof
  • Helicobacter pylori HefC recombinant protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Construction of pET29b-5 double-promoting label carrier

[0046] (1) His tag, MBP, GST gene cloning and connection

[0047] 1. The MBP gene is derived from the pMAL-c2X plasmid (Changsha Youbao Biotechnology Co., Ltd.), and the GST gene is derived from the pGEX-6P-1 plasmid (Changsha Youbao Biotechnology Co., Ltd.).

[0048] 2. The protein amino acid sequence of His tag-MBP-GST is selected from SEQ ID NO.3, and the nucleotide sequence is as SEQ ID NO.4.

[0049] 3. According to the principle of primer design, design corresponding primers and add enzyme cutting sites. The primer sequences are listed in Table 1.

[0050] Table 1

[0051] Primer name Primer sequence (5'-3') serial number F29b-1 CATCATCATCATCATCATAAAATCGAAGAAGGTAAA SEQ ID NO.5 R502 ATAACCTAGTATAGGGGAAGTCTGCGCGTCTTTCAG SEQ ID NO.6 F502 CTGAAAGACGCGCAGACTTCCCCTATACTAGGTTAT SEQ ID NO.7 R503 CATG CCATGG ACAGGGGCCCCTGGAACAG

SEQ ID NO.8 F29b-2 ...

Embodiment 2

[0079] Example 2 Construction of HefC gene

[0080] (1) Cloning of HefC gene

[0081] Helicobacter pylori SS1 strain was obtained from China National Institutes for Food and Drug Control.

[0082] For Helicobacter pylori culture, refer to conventional conditions, recipes and operating methods in the art. The Helicobacter pylori culture was taken for genome-wide extraction, the extraction system and procedures were referred to the instructions, and the extracted products were stored at -20°C for later use. The bacterial genome extraction kit was from Shanghai Jierui Bioengineering Co., Ltd.

[0083] According to the principle of primer design, the corresponding primers of HefC gene were designed, and restriction sites Nco I and EcoR I were added. The primer sequences are as follows:

[0084] F61-1: 5'-CATG CCATGG AAAAATTGAGCGTGGCGC-3'; SEQ ID NO. 10;

[0085] R61: 5'-G GAATTC TCATTTCACGTCTTCAATAGAGGT-3'; SEQ ID NO.11.

[0086]The high-fidelity PCR method was used to a...

Embodiment 3

[0115] Example 3 HefC Escherichia coli fermentation

[0116] (1) Inoculation and culture of pET29b-5-HefC Escherichia coli

[0117] The constructed pET29b-5-HefC Escherichia coli engineered bacteria were taken out from the -80°C ultra-low temperature refrigerator, and the engineered bacteria were inoculated in LB-1 medium, and incubated overnight at a constant temperature of 37°C and 220rpm. The composition of LB-1 medium is the same as in Example 1.

[0118] (2) Expanded culture of pET29b-5-HefC Escherichia coli

[0119] The engineered bacteria cultivated overnight were taken out, inoculated into TB medium at an inoculation ratio of 1%, a total of 4 L was inoculated, and incubated at 37°C and 220rpm for 3 hours. The composition of TB medium is: potassium dihydrogen phosphate 0.2312%, dipotassium hydrogen phosphate 1.2540%, yeast extract 2.4000%, tryptone 1.2000%, glycerol 0.4000%, defoamer 0.0500%, solvent is water.

[0120] (3) Escherichia coli induced expression of pET29...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
correlation coefficientaaaaaaaaaa
correlation coefficientaaaaaaaaaa
Login to View More

Abstract

The invention discloses a helicobacter pylori HefC recombinant protein and application thereof, and belongs to the technical field of genetic engineering. The invention discloses the application of the helicobacter pylori HefC recombinant protein in preparation of a helicobacter pylori vaccine. The helicobacter pylori HefC recombinant protein is cloned and expressed by adopting a genetic engineering technology, the supernatant expression quantity is high, the separation and purification steps are simple and convenient, the immune titer is high, and the helicobacter pylori HefC recombinant protein has protectiveness. The HefC recombinant protein can be directly matched with a mucosal adjuvant LT(B)5 for use, and is suitable for oral immunization.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, and more specifically relates to Helicobacter pylori HefC recombinant protein and its application. Background technique [0002] Helicobacter pylori (Hp) is an infectious disease. Helicobacter pylori infection is clearly related to chronic gastritis and peptic ulcer, and Helicobacter pylori infection is the main cause of gastric cancer. After Helicobacter pylori infection, there is no "H. There are differences in Helicobacter pylori infection in gender, age, occupation, living area, living habits, and familial clustering. In the current standard quadruple therapy, the types of combinations of 6 antibiotics in the eradication plan are increasing, the dosage of acid-suppressing drugs and antibiotics is increasing, the course of treatment is extended from 7 days and 10 days to 14 days, and the side effects are also increasing. The decline in the eradication rate of Helicobacter pylori ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/195C12N15/31C12N15/70A61K39/02A61P31/04
CPCC07K14/195C12N15/70A61K39/105A61P31/04
Inventor 杜方川童文德朱白梅童武学税静
Owner CHENGDU OLYMVAX BIOPHARM
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com