Method for constructing and optimizing ectoine producing engineering strain

A technology of ectoine and engineering bacteria, applied in the field of bioengineering, can solve problems such as difficult extraction, high cost, and long fermentation cycle, and achieve the effects of simple cultivation conditions, high production efficiency, and low equipment loss

Pending Publication Date: 2021-07-30
JIANGNAN UNIV
View PDF7 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Tetrahydropyrimidine can be produced by moderate halophilic bacteria by "bacterial milking" method, but this process relies on the induction of high salt stress, long fermentation period, difficult extraction and low yield, and is not conducive to equipment maintenance. Problems such as the chiral structure of hydropyrimidine lead to an increase in the difficulty and cost of chemically synthesizing ectoine
Xie Xixian et al. (201510410080.2) constructed E.coli W3110 with a specific genotype, including the ectABC gene from Halomonas elongatus; three gene deficiencies of lysA, thrA, and iclR; and a glutamic acid rod controlled by the lac promoter. Bacillus lysC gene; ppc gene controlled by trc promoter, after 20-28 hours of fermentation with glucose as the substrate, the ectoine production reaches 12-18g / L, but the key branch pathway leads to amino acid deficiency, which will inhibit the bacteria to a certain extent Growth, causing a certain pressure on the bacteria, and then affecting the production of ectoine
Wang Hong et al. (201810996222.1) constructed E.coli MG1655 with a specific genotype, including the ectABC gene of Halomonas elongatus; the lysA gene-deficient type, and sodium L-aspartate as the substrate, and synthesized tetrahydro Pyrimidine, the yield reached 2.53.5g / L in 2030h, but the whole-cell catalytic fermentation process is complicated and the cost is high
The production of ectoine by the above two Escherichia coli is not high, which greatly affects the research progress and commercial application of ectoine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing and optimizing ectoine producing engineering strain
  • Method for constructing and optimizing ectoine producing engineering strain
  • Method for constructing and optimizing ectoine producing engineering strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Embodiment 1: Construction of recombinant plasmid pRSF-Ect

[0071] (1) The ectopyrimidine synthesis gene cluster ectABC shown in SEQ ID NO.1 was synthesized by Jinweizhi Company.

[0072] (2) Extract plasmid pARSFDuet-1, design primers Ect-F1 / Ect-R1, and use plasmid pRSFDuet-1 as a template for PCR amplification to obtain a linearized vector.

[0073] Ect-F1: acgaccagaagccgctgtaacctcgagtctggtaaagaaaccg;

[0074] Ect-R1: ggctctgtggttgcgttcattatgtatatctccttcttatacttaactaatatactaagatgggg;

[0075](3) Ligate the fragments obtained in steps (1) and (2) with one-step cloning enzyme, mix the obtained recombinant vector with E.coli JM109 competent cells, and place in ice for 30 minutes.

[0076] (4) Rapidly heat-shock (42°C, 90s) the mixed system after the above-mentioned ice bath, then quickly place it on ice, let it stand for 2 minutes, then add 900 μL LB liquid medium without antibiotics in the sterile room, and restore the culture (40 -60min, 37°C, 220rpm).

[0077] (5...

Embodiment 2

[0078] Embodiment 2: recombinant bacterial strain ECT construction and batch fermentation

[0079] (1) Transform the recombinant plasmid pRSF-Ect obtained in Example 1 into E. coli BL21(DE3) competent cells to obtain the recombinant strain ECT.

[0080] (2) The ECT of the bacteria to be activated is taken from a glycerol tube stored at -80°C, streaked onto a kanamycin-resistant LB solid medium with a sterile inoculation loop, sealed and inverted, and cultured at a constant temperature of 37°C for 12-16 hours to a long time single colony.

[0081] (3) Pick a single colony from the activated LB plate and inoculate it into a 50 mL centrifuge tube containing LB medium (the volume of liquid is 5 mL), and culture at 37°C and 220 r / min for 8 hours to obtain the seed liquid.

[0082] The cultivated seed solution was transferred to a 250mL Erlenmeyer flask with a sample volume of 30mL in the batch fermentation medium at an inoculum size of 2% (v / v). The cultivation temperature was 30°...

Embodiment 3

[0083] Example 3: Construction and verification of recombinant plasmid pACYC-LysC

[0084] (1) Genes ppc, pyc, aspDH, lysC shown in SEQ ID NO.2-7 C932T , asd, and rocG were synthesized by Jinweizhi Company.

[0085] (2) Extract plasmid pACYCDuet-1, design primers Ppc-F1 / Ppc-R1; Pyc-F1 / Pyc-R1; AspDH-F1 / AspDH-R1; LysC-F1 / LysC-R1; Asd-F1 / Asd-R1 ; RocG-F1 / RocG-R1, using the plasmid pRSFDuet-1 as a template, carried out PCR amplification to obtain a vector that achieves linearization at the expression frame of the second T7 promoter.

[0086] Ppc-F1: cgctgcgcaactccggctaggctgccaccgctgagcaataa;

[0087] Ppc-R1: tcgcgtaaaaaatcagtcataaaaaaacctccttatacttaactaatatactaagatggggaattgt;

[0088] Pyc-F1: tgatcgtcgtcgtttcctaagctgccaccgctgagcaataa;

[0089] Pyc-R1: ataacaattcccccatcttagtatattagttaagtataaggaggttttttcgtgtcgactcacacatcttc;

[0090] AspDH-F1: gcccacgcgatttcgatctaggctgccaccgctgagcaataa;

[0091] AspDH-R1: atcatgacgatattcagcataaaaaacctccttatacttaactaatatactaagatggggaattgttatccg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing and optimizing an engineering strain for producing ectoine, and belongs to the technical field of biological engineering. The invention provides an Escherichia coli engineering bacterium ECT-LA capable of producing ectoine under a low-salt condition. The bacterium is based on escherichia coli E.coli BL21 (DE3) and comprises an ectoine synthetic gene cluster ectABC controlled by a T7 promoter and exogenous genes lysCC932T and asd; a preparation method of ectoine is optimized futher. The recombinant escherichia coli constructed by the invention takes glucose as a substrate, and the yield of ectoine can reach 60g / L after fed-batch fermentation is performed for 56h.

Description

technical field [0001] The invention relates to a method for constructing and optimizing an ectoine-producing engineering strain, and belongs to the technical field of bioengineering. Background technique [0002] Ectoine, also known as Ectoine, belongs to aspartic acid derivatives. As a compatible solute, it can help cells maintain the osmotic pressure balance inside and outside the cell; interact with macromolecules such as proteins and nucleic acids and cell membranes In order to improve its stability and improve the ability of cells to withstand extreme environments such as high temperature, high salinity, high pH, ​​and radiation, it has been widely used in new cosmetics, drugs, skin wound repair, and organ transplant maintenance. [0003] Tetrahydropyrimidine can be produced by moderate halophilic bacteria by "bacterial milking" method, but this process relies on the induction of high salt stress, long fermentation period, difficult extraction and low yield, and is not...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12P17/12C12R1/19
CPCC12N9/88C12N9/93C12N9/0016C12N9/1217C12N9/0008C12N15/70C12P17/12C12Y401/01031C12Y604/01001C12Y104/01021C12Y207/02004C12Y102/01011C12Y104/01002Y02A50/30
Inventor康振王阳陈坚堵国成王道安
OwnerJIANGNAN UNIV