Codon-optimized danio rerio g-type lysozyme-1 gene and recombinant expression protein thereof

A technology of codon optimization and recombinant protein is applied in the field of zebrafish g-type lysozyme-1 gene and its recombinant expression protein, which can solve the problems of bacterial stress response ability and unknown function, and achieve the effect of high bacteriolytic activity

Pending Publication Date: 2021-10-26
BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that zebrafish have c-type and g-type lysozyme, which may play an important role in the defense against Vibrio vulnificus, but the stress response ability and effect of the two lysozymes on bacteria are unknown

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Codon-optimized danio rerio g-type lysozyme-1 gene and recombinant expression protein thereof
  • Codon-optimized danio rerio g-type lysozyme-1 gene and recombinant expression protein thereof
  • Codon-optimized danio rerio g-type lysozyme-1 gene and recombinant expression protein thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Codon optimization and expression vector construction of zebrafish g-type lysozyme-1 gene

[0020] The open reading frame sequence of the zebrafish g-type lysozyme-1 gene (accession number: NM_001002706.1) was obtained from the GenBank database, as shown in SEQ ID NO.1. First, signal peptide analysis was performed on the sequence, and the signal peptide sequence ATGGGCATTCCGGTGATACTTACCATGTATTTCTAGCATGCATTTATGGA in the sequence of SEQ ID NO.1 was removed. According to the codon preference of Escherichia coli and the principle of avoiding repetitive sequences, the codon optimization software was used to optimize the codon of the gene sequence without changing the amino acid sequence ( figure 1 ), and joined at the 5' end of the sequence Bam HI restriction site, added at the 3' end Xho I restriction site. The codon-optimized zebrafish g-type lysozyme-1 gene nucleotide sequence is shown in SEQ ID NO.2, and its encoded amino acid sequence is shown in SEQ ID ...

Embodiment 2

[0036] Example 2 Expression and purification of zebrafish g-type lysozyme-1 gene

[0037] The recombinant plasmid 28a-Lys-g1 was transformed into BL21 (DE3) Competent cells, pick a single colony and culture in LB liquid medium containing 50 μg / ml kanamycin, when the OD 600 When the value reached 0.6, IPTG was added to a final concentration of 0.5 mM, and cultured at 20°C for 16 h. The cells were collected by centrifugation, resuspended in imidazole buffer, disrupted by ultrasonication, and the supernatant was collected. Take 5 mL of Ni-NTA and wash the equilibrated column with 5 times the bed volume of Binding buffer at a flow rate of 5 mL / min. The supernatant was incubated with the equilibrated column packing for 1 h, and then loaded onto the column. The equilibrated column was first washed with urea buffer, then washed with urea-containing imidazole buffer and eluted, and the effluent was collected. The purified protein was dialyzed and concentrated, filtered through a ...

Embodiment 3

[0038] Example 3 Determination of zebrafish g-type lysozyme-1 recombinantly expressed protein concentration and activity detection

[0039] The concentration of purified zebrafish g-type lysozyme-1 recombinant protein was determined by a non-interfering protein concentration assay kit (Sangon Bioengineering (Shanghai) Co., Ltd.). First, take 12 1.5 mL centrifuge tubes, each with the same number, and add 0, 4, 8, 12, 20, 25 μL of BSA standard protein solution (2 mg / mL) to the centrifuge tubes with different numbers, respectively. Add the same volume of protein standard solution to the same numbered centrifuge tube. Then take two 1.5 mL centrifuge tubes and add 10 μL of recombinant protein solution to each. Add 0.5 mL of Precipitation Reagent 1 to each of the above 14 test tubes, vortex for 30 sec, and place at room temperature for 2-3 min. Then add 0.5 mL of precipitation reagent 2 separately, and vortex for 30 sec. Transfer to a refrigerated centrifuge and centrifuge at 13,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a codon-optimized danio rerio g-type lysozyme-1 gene and a recombinant expression protein thereof. The danio rerio has three lysozyme genes in total, namely c type lysozyme, g1 type lysozyme and g2 type lysozyme. The danio rerio g-type lysozyme-1 gene is obtained through optimization and is obtained by adopting a whole-gene synthesis mode after codon optimization, the nucleotide sequence of the danio rerio g-type lysozyme-1 gene is shown as SEQ ID NO.2, and the coded amino acid sequence of the danio rerio g-type lysozyme-1 gene is shown as SEQ ID NO.3. The gene is connected with a carrier pET-28a (+) to obtain a recombinant plasmid 28a-Lys-g1, the recombinant plasmid 28a-Lys-g1 is further transformed into escherichia coli BL21 (DE3) competent cells, and the danio rerio g-type lysozyme-1 recombinant protein with high purity and high bacteriolytic activity is obtained through induced expression, purification, SDS-PAGE verification and renaturation.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology and genetic engineering, and in particular relates to a codon-optimized zebrafish g-type lysozyme-1 gene and its recombinant expression protein. Background technique [0002] Lysozyme (Lysozyme), also known as N-acetylmuramic acid hydrolase, can destroy pathogenic microorganisms by destroying the 1,4-glycosidic bond of peptidoglycan in the cell wall. It was first discovered in Bacillus subtilis in 1907, and lysozyme crystals were first isolated and prepared in 1937. According to different sources, structures and physical and chemical properties, lysozyme can be divided into egg white lysozyme (Chicken-type lysozyme, c type), goose lysozyme (Goose-type lysozyme, g type), invertebrate-type lysozyme (Invertebrate-type lysozyme) lysozyme, type i), bacterial lysozyme, plant lysozyme and bacteriophage lysozyme (P type), among them, c-type, g-type and i-type lysozyme belong to animal lysozyme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/56C12N9/36C12N15/70
CPCC12N9/2462C12N15/70C12Y302/01017C12N2800/22
Inventor陈华葛均青
OwnerBIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI