Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Grifola frondosa glucanyltransferase gfgel4 as well as encoding gene and application thereof

A technology of coding gene, Grifola frondosa, which is applied in the field of edible fungus genetics and genetic engineering, can solve problems that have not been systematically studied, and achieve obvious effects of industrial production, genetic stability, and increased polysaccharide synthesis

Pending Publication Date: 2021-11-12
江苏康铂特医食品有限公司
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most edible fungal glucans contain different proportions of branched structures, how these branched structures are formed, and which enzymes are involved in the remodeling of glucan branching have not yet been systematically studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Grifola frondosa glucanyltransferase gfgel4 as well as encoding gene and application thereof
  • Grifola frondosa glucanyltransferase gfgel4 as well as encoding gene and application thereof
  • Grifola frondosa glucanyltransferase gfgel4 as well as encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Cloning of the gene encoding Grifola frondosa β-1,3-glucanosyltransferase

[0044] Grifola frondosa GF02 was collected by centrifugation (purchased from American type culture collection bank, American type culture collection, 60301 TM ) to cultivate mycelia, quickly add liquid nitrogen and grind it into a fine powder, and extract the genome through a plant or fungal genome extraction kit.

[0045] Primers were designed according to the published Grifola frondosa β-1,3-glucanosyltransferase gene (GenBank ID: A0H81_00473), respectively:

[0046] gfgel4-F (SEQ ID NO.7): 5'CCACCTCCGCACACGCATC 3',

[0047] gfgel4-R (SEQ ID NO. 8): 5'CGTGTCCACCACTCTACCCTC 3'.

[0048] The published Grifola frondosa genome (GenBank assembly accession: GCA_001683735.1) was used as a template to amplify the full length of the gene with the above primers. The PCR reaction procedure: pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 20 seconds, annealing for 30 second...

Embodiment 2

[0050] Example 2: Construction of the gene silencing vector pAN7-gfgel4-dual and gene overexpression vectors pAN7-gpd-gfgel4 and pAN7-35s-gfgel4 of the gene sequence of Grifola frondosa β-1,3-glucanosyltransferase

[0051] According to the gene sequence (gfgel4) of the Grifola frondosa β-1,3-glucanyltransferase cloned in Example 1, the PCR primers containing homology arms upstream and downstream are designed according to the homology region, respectively:

[0052] gfgel4-i-TF (SEQ ID NO.13): 5'-TTGTACCCACCAGTACCTGCAGGAAAAATGGCCTCGCCTTCAGCT-3',

[0053] gfgel4-i-TR (SEQ ID NO. 14): 5'-GCAGCTTTAAGCTTGCATGCCTGCAGGTTTTTTTACCGCTGAAGTCGCAC-3',

[0054] gfgel4-TF35s (SEQ ID NO.15): 5'-CACTCCACATCTCCACTCGACCTGCAGGCCACCTCCGCACACGCATC-3',

[0055] gfgel4-TR35s (SEQ ID NO. 16): 5'-GGCAGCTTTAAGCTTGCATGCCTGCAGGCGTGTCCACCACTCTACCCTC-3',

[0056] gfgel4-TFgbd (SEQ ID NO. 17): 5'-ACCAGTACCTGCAGGCATGCAAGCTTCGTGTCCACCACTCTACCCTC-3',

[0057] gfgel4-TRgbd (SEQ ID NO. 18): 5'-TGTAAAACGACGGCCAG...

Embodiment 3

[0071] Example 3: Preparation of Grifola frondosa protoplasts by incomplete enzymolysis

[0072] Collect the mycelia obtained from the Grifola frondosa PDA liquid culture, process it under aseptic conditions with a tissue grinder for 1 min, inoculate 100 mL of PDB medium with 10% inoculum size, and after standing at 28 ° C for 4 days, centrifuge at 5000 g for 15 min to collect insoluble matter; Wash twice with 0.6M mannitol solution, add 1mL of 2% filamentous fungal wall breaking enzyme solution, and enzymatically hydrolyze at 30°C for 4h. The enzymatic solution was centrifuged at 5000g for 15min to collect insoluble matter, and the protoplasts obtained by sterile filtration were obtained; the prepared protoplasts were added to 50mL regeneration CYM medium (glucose 20g peptone 2g yeast extract 2g magnesium sulfate heptahydrate 0.5g dihydrogen phosphate Potassium 1.0g potassium dihydrogen phosphate 0.46g agar 20g, hygromycin 100μg / mL) mixed evenly, poured into a plate, cultured...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses grifola frondosa glucanyltransferase gfgel4 as well as an encoding gene and application thereof, belongs to the technical field of edible mushroom inheritance and genetic engineering, and particularly relates to the grifola frondosa glucanyltransferase gfgel4 as well as the encoding gene and application thereof. The encoding gene of a key enzyme beta-1, 3 glucanyltransferase for forming a branch structure in the glucan synthesis process is cloned from a grifola frondosa mycelium genome for the first time, and the key role of the gene in the grifola frondosa mycelium growth process, the glucan synthesis process and the glucan branch structure forming process is proved through gene silencing; finally, through a genetic engineering technology, beta-1, 3 glucanyltransferase is overexpressed in grifola frondosa, so that the synthesis yield of glucan is increased, and meanwhile, the branching degree of glucan is increased; and according to the invention, the synthesis mechanism of edible and medicinal fungus polysaccharide can be understood from the molecular level, and a technical scheme and guidance are provided for modifying a glucan synthesis route of edible and medicinal fungi by utilizing the genetic engineering technology.

Description

technical field [0001] The invention belongs to the technical field of edible fungus genetics and genetic engineering, and specifically relates to glucanyl transferase gfgel4 and its coding gene and application. Background technique [0002] Edible and medicinal fungal polysaccharides are currently one of the most active research fields at home and abroad. They are widely involved in various life metabolic activities in cells, and have various biological activities such as anti-tumor, anti-virus, anti-oxidation, and immune regulation. Among them, glucose Glycans are polysaccharides formed by the polymerization of D-glucose through β-1,3 and / or β-1,6 glycosidic linkages. They have a variety of biological activities, and polysaccharides with moderate branching tend to have higher biological activities. Activity, for example, Grifola frondosa dextran with a branching degree of 0.31-0.36 has strong immune activity. [0003] However, the synthesis process of edible and medicinal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/80C12N1/15C12P19/08C12R1/645
CPCC12N9/1051C12N15/80C12P19/08C12Y204/01034
Inventor 崔凤杰朱业君汝成业顾韬朱鸿安
Owner 江苏康铂特医食品有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com